Description :
From Genome Similarity Track
Location :
Scaffold_4:1539416- 1546647
Transcript NameFunction/comments
Phyin_T30-4PITG_03374Putative uncharacterized protein
Phyin_T30-4PITG_03375Putative uncharacterized protein
Phyin_T30-4PITG_03376Endomembrane protein 70-like protein%2C putative

Sequence
7231 bases(100 bases per row)
CATTGGCATTCTCTCGTCGCTTCTTCGCTTCTGCGCCAACACGTTTGAACTTCTTGCTCTCCGTCTTGTTCAGACCGCGATACTTTTGTTTATCCCAGCG
GGACATCTGCAAGGAATCCCGGCACCCAGCACCACCTTCCCAGTGCTGAGAGGTCGATCTTTTCGATGCTACGTCGTTTCCGCAGGGACACAATTTAGTC
GAACTCGATTGCTCCTTCGAGCACAAGCCGCAAATCATCCGACTGGCGAATTTCCCAAGGTTCGCTTCAGGGCAGTCACTCGAGTCGTGGCAAACATCGC
ACGGGAAGGCTTTACCACAGCACTGAAACCTAAACCAGCGTAGCGAGTGTTTGTAGTGGTCGCACGCTCCGTTGCGAGGCAGCGGCTGTCCCAGTACGAA
CGTCTCCACGATCTGTTTGGCTCCTTTCTTGCTGCTTTTGGCAACCTTTGACGCAGTACCGTCGGGCGAATGACTACGTTTAGTGCTTGCCCCCTCCAGT
TGACCAGCCACGAAGCGCTTTGCCATCACAGCAAGTTTGACGTGACAGGAAAAGCATGATTGCTCTGCTCGTTGTCTTGGCGTAATCCTCTCCAGTAATG
CTTCGCACCCACACTCCAAGCAAGTGGCTAACATATCCGTGGGGAGCACGTCGACAATTGAGCAGTTCTCAGTGTCAACGTAAGCTAGAATATTGCTTTG
CGAATGGGCAAACACCGGCCTCATCACCACGTGGTGAAGCACACTGCATCGAGGGCACCACTTCTGAATTTCTGACGAGTCCAAACTCAGGATAGCGTCG
AATTTAAGCGGACAGTTTTCGCACTGGACCTGGCAAACCAATCGATGAGCCACCAGCGTGCCAACTTCGTGCAGGAACAGATCATCGAGGCAGATTTGAG
TGCCCTTGACTTCAGGTTCTGTCTGGATAGTAACACGCTTTTCAAGGGGAGTGATTTTTGAGTTTCGAGCGTCATGTTCGCTTCTGTTTGTTTCTACTGG
TTCCTCCTCGTCCTTCTCCTCGTTAGCAGCAGCCGTAGGATCCACACCACGCCGCATAAGCTCACACAGCATTTTGAAGCGGTCAATGCATTCGTTCAGG
GACCTCCCCTCGACCTCGCTTGCTATGTTTGTCCATCGTTCCTTTATGTCCATCGAAGCTGGATACTTTTTCAAAGCCAGGTCAAGTGCTCGCTGTTGCA
CTTCTGACCACTCTGAGCTGTCTTCAGCTTGACTGATACAAATCTCACTGTTGGATGGCGCTGACGTGATTTTCACCTCGGCATCAATGACTGGAGCTTT
AGTTGGAGAGCCCAGCTGCACAACAGCAGCACGTGGCAGGGCATCTGATCGTTGCTTTGCACCATTGCTATTTGTTCCCGTGTTCTTGAGCTCGTGCGAA
AACTTACATTTATCTCCGTCGCGACACTTGCTCTGGGCGAAGAACTTGCACTTACGTGTCCGCGTTTTCTTCTTCTTCGGTTGTGCTGCCACCACAGGTG
GGCGTGTCGGGTCAGCTTCTCGAACAGCCGATACTGAATCAGCACCGGGAGCGTCAGAGCCATCTCTTTCACTTACAACCTCCTTCTTTGCGTGCGAGAA
CTTGCACTTCTCTCCATCTCTGCAGTTGCCTCTAACGAAAAATCGGCAGGGTCGTTGGCCACGCCTTCTCTTTGATTTCTTATCTGCAACAACTGGGACT
TCTCCAGCCAAATCCTCCTCGCCCTGTGCGCGGCTCACTTCTTCTGCTTCCTTCTCTGCTTCAAGGCCTTTCTCAAACGGTGCAATGACTCTCCAGAAAT
TATTGTCGATCCAGGTCAGTAGGTTCCTCAGCGCGAAGCCTCCACACAGCTGCTGAGCTCTGGCATTCACCGCAACGTTCAGCGCTTCAACCTGCTCGTC
CGACAGTCGACTGTTCCACTGCGTGAAGTCCACATAGGCAGCCTCCACCGGGTAATTTCCCGGTAGCGTCACCTCCAGCTCGACTTGGCCCGTCAGCCGA
GTCGGCAGCTCCGGATCCAACAAACTTAGGAAAAGACGCACATGCTTGTCTTGCGTCGCAGGGTCCTCACAGCTCAGCTGCAAGTTATAGCGGCGCTCCA
GTGCCATCCACTCCTTCTTGGCGGCGTCCGTCTCGCTCGCCAGCGCCTCCTGCCAGCTCAGGTCCGCCATGATGCTGCTGTACCGGTACGAAAATGTCAA
CTTCTTTGCTGGAAGGCAAGTCCGAGAATGAGAATCTTTACCAAAATATTTATTGGGTTCTAGTGATTTTTCACTGTTCCGGAAGAAAAGTTCCCCGAAA
CTTCGGTCAGGTTCACTATTTTTTTTAACTGCGTACCATGTGGAGTATCCGTCTTCGTGGGCCGCGCGGCAAGCAGGTGGTGCTGAAGATCGACCCAGGA
GCCAACCTTAAGACGTTCTCAGGTTTGGGTGCTGCATTGCATGAGTGTTTGTCTCTCCTGTATGTCTGAAGGTTTTGTTTTTTGCAGAGCTGGCAGTGAA
GGAATTGGGGTTGAAGGCAAAAGACACACCAATTTGTACGCGGCCGACTCTATAGTGGATAATTGCGGTTGGCTTGCGCTAATACTTTGTGTTACAGTTC
GCAAAGGTTTTCCACCTCGACCTGTGGAAGTGGATGGCTCAGCATTGGTCAAGTTCGTCTTCGAGGCTAACGACACGGTGGTGGTGGACACTGGCACGGG
TGCTGCTGCTCCAGTGCAAGCTGCTAGCGCGGCCTCTAGTACTGCGAAGAAGTCCGCAGGGAGACCGAAGCGAGCTGCTGCAAAGAAGCCAGCGGTTGAA
GCCCCGAAAAGTAGTGTGCACACTCTGAACCCTCCCACCAGCTCTAAAAAGAGGGCCCAACCGAAGCGAAAAGTTACAGCCAGTGGGCATCAGCTTGGGA
GCTCACTGGAAAACGACCCGTCGGAAGCTGCAGGAGTTGAAGGTGATGGTGAAGATGAACCACAACGCAAATATCGCCGAAGTAAAGCGATTAATCTCAA
TTCGAAGGAAGATGTGGAGATCAGTCTGGTGAACGCTGTGAGCGGCCAATCCCACGGCCGTGCCGCCAAGTTTTTCCGTGCGGCAACGAAGAATGCCGTG
GAGCATCAGTATGAGACAACACTGGCCACTTCCAGACTGAATGCAGCATTGGCGCATAAATTTGAGATCGAAGAGCTGTCGACTGCCCGGCGTGCTGATG
GAAGCGCCGCTAAACTTCGTGTGCGCTTCAAGGAAACACCGCGCAAGTGGAAGGAGGAGACAGTGGATCTACTGAAGACGGACGAGCTGCAAGCCATTTT
GAAGTATGTGCTGATATCGGGCGGCGAGACTGGACGTGAAATGCTCAAGCCATTCAACATGGCGCAAGTGTCAACTAGAGTGTTTTGGAGTATTGCGCAC
CTGTACGATGGCGATGTGGCTGCTGGACTAGCAGACCTTGTACCTGATAAAGATTGGTCGTTCTTGGACACTCGTACGCGGTGAGTTTGGTCTTCGTATG
GAACAGGAATCTTGTTTTTGACGTGTAATACTGTCACGTTACAGAGTCATGTCGGAGAAGGCTATGGAGGCTAAGGCAAGAGGCAAACACTTTCAGCTGC
GGGTGTTTGGGACGATCTCATAATGTCTTTCATGGTTATTGCTAGGCAAATGAAGAGCAGTATAAGCGGTGGAAGCAGGAAAAGCAGGGGGATACTCAAA
GCAGTCGTGCGTCTTCTTCGAAATCAGAGAGTAAGAAGGAAGCTAAGCCAGCAAGACGCCCTGCAGCTAAGGAGACGAAGCCTGAAGTAATTGTAGTGGA
CTCAGATTATGAAGAAGAGACAAAGCAAGAGCCCGCGGAGCCAAAACCAAAGCCAGTATCTCACACACCTGCTCTTTCAGCGAAAGAGGCGACTCCAAAC
ATGCTGCGTAGCGCAGCGGCACACGCTGCGTTGGCCCGATTCGACCGAACTGCGCATACAAGTGCTGTTGTATCGGCTTTTCTTCCAGCTAACCGGCCCG
CAATAAAGAAAGTAACGACAGTCGACGACGAGGACACCGAGTCCGATGAAGAGGTTGAGGAAGCCACTACTGTGTACTGCGATGTCTGCAAGAAAGCGCG
TATTTTATCAGCAGAGGAAGCAAGTAACGCTGAACTGGAAAATGACCCGTGGACCTGTGCCAGCTTGGCAAAGGCTGGTCGCAGCGGTGGGTGCGACGCT
GTCGATGATGAAGTGGCCCAGATTACGGGTGCTCCCATTGCTGAATGGTTGAAAAAGGCTTCAATTACTACTCGCCTAGAGCTGGCCGACGCTTCCATTG
GCGCAACACTGCATTCTCTTGTGAATCCATTGGACCCATCAGCACAGACGCTGCAGGAAAAACTTGAAAAGTTGATCGATGAGGTGAGTGAGCCTGAGTT
GTTGGTGTAGCTTTGGTCGACGATAACTACTTGGCTAACGGTATGTGAATGAACTAGGCGCGTCTTGATGAGGTGAACGACTGGATGACAGAACTTGTTG
GTGCGACCGAAGTTCTACAGCAACTGGAGGTACAGAAGCTTGGCACGCTGGCCGATTTGATCGCCACACCGACCGACTTGATCGTCGAAGCTGTTGGCAC
TGCTGCTGATGTGTCTCTCCAAGTGGTCAGCTCGTGGCAGACTCGTGCCAAAGCTCTGGTGGACGAGCACCCGTGGTTGGCAGAATGGCGAACGCTTTAG
CGGAGCTCCAATCGCGTGTCTGAAAGTGACACTGCTTGGATATTCACGGCAGATTGAAAACGGAATGAAAATTATTTTCCTACGCTTCCAGGCTTTCTGT
TCTACACACAGGAAGCAACAAGCGGCATATGCACGACTCAGCCTACAGCTGTCAATACTCATGTAGCTCCCGGCTTCTACCCTCCTTCGTTGCTGCTTCA
CCCCCCGTTACCTCCCGCTATATTGCTTCATCGCACCATTCGGTGACTGGAGCCTTGATTCGCTACTTAGTCGATCTTAATGGAGCTGTAGATCTTGCGC
GTAAACCAGAGGCAAGCGAAGTAGCCGATGGTTCCCGTGAGGAAGAAGAACGTGACCGAGATCAGGAACATGTAGCCGAAGTACAGAATGCCCGAGACGA
ACGCCGTGATGTTCAGCTTCGTAAAGAAGTACAGGAACGAGTACAGGAACAGATACACGGCTGCAGATCCAGAGGTGAGGAACGAGCGCCACCACCAGCG
GTAGTCCTCTGCGCAGAGCTGGAAGTAGCACATCACGACCGTCACCTCAGCGCACGTGGCCACGAGAATCAACAGCACAATGAACAGGAAGCCGAAAACG
TAGTAAATCTGGTGCAACCACAGCGCCGACATGATGAAGAACAGCTCAATGAACACAGCGCCGAACGGCAAGATGCCACCAACCAAGATACTGAAAGGCG
AGGACAAGTACCACACTTGCTCCGGGATCTGGCGTGCGATCTGGTTCGTGCGCACAGGCTGCTCAATAGCAGCAGCCTTGAAGCCAAAGTAGCTGCCGAG
GAACACCAGCGGTACGGAAATGCCGAACCACAGCACAAGCAGAGCGAAAAGCGTACCGAACGGGACGGCCTGCGACGATGACTTGCCCCACAGCACCAGG
TTCAGCACGAAAAAAACGGCAAACAGCAGACCGGGGTACAGCACAGCCGTGAGAATCGTGTTCTTCTTCCAGTCCTTGCCGTTGAACATCTTGTACGTAC
GTGACGAGTGGTAGCCAGCGAAGCTGCCCATGAACACGAAGAGCAGCAGCAAAGTCGTCAGTAGAGAGCCACGATTGGCCGGCGACAACAGTCCCAGCAG
CGCAATAACCATCGTTGACGCGCTCATGGAGCACACCTGGACACCTGTACCCACGACCACCGAGAAAAGCATGGGTGAAAGCTGCGGCGGACGGAATACA
TCACCGTGGACAAGCTTCCACCCTGACTCCTCCTGAGCCTCCTCCGTGGTCTGCACCTCATTGTAACGAGCGATGTCACGGTGAAGTGTGCGCAACATGA
TCATAGCGATCATTCCCGTCAGGAACAACACGATCATAAGCGAGTTAATGATGGAGAACCAGTGGATCTGATCGTTCGAGCTCTTGCTGCTGATAATACG
GTCCCAGCGCTCCTCCCAGACGATGTCTGACTTGACGAACTGCACATCGTACGTGTACAACACCGTGGTCTCGCCCTCTGGGTTCAAGTACTGGTAGTTG
CCCTGTGAAACCTCCTCAATGTTTACAAACTTGCCACACGTGTCCGAGTCGAGTTCCTGTCCGGCCATAGGCTCGTTCTCGTAGCTGTGCTTGATAGAGG
TGGGGACGACCTCGAAGCCGACGACGCGCCACTTAGGGGCGTCACCGTCCTCTTCGGCGTATGGATCCGAGTTGACCGAGACGATAATGCGCACGTGGTT
GTACAGGAGGTACTTTCCGTCTTCGTCCACTTCACCAACGGGGAAGCCGCGCTTGAAAGATCCAGCCTGCTGTGAGTCCGTCGGGTCGCGGTACAGCACG
GGCAGATTATCCACCACCCACTGTACGTAATACTCGTCTTTGATCATGTCGATAAAGGTCTGCGACTGCTCAGACGTGTACGTCATGGGCTTACACAGTA
CCTGGCAGATTGCGTCCTTCTCCATCTGCATATTGTAGAGTGAATCCATTATGGCATCACCAGCCATGATCTCACCCAGATTCTCCTGTTGCTCGTTGGT
GGAAGTGGGTTTGCAATACGGCAGGTAGTAGTACTCGTACGGCACGAGCGTCTTGGTGGACGTGATCTTGTTCACGTTAAGGCGCACCGTCTCGCCCGCT
GCCCACGATTCGGGCGCCACGCCTGGCACGTAGAAGGCTGCACTGGCCTCTTGCACCGCCAGAAGCGCGGCCAACGCCGTCGCCGCCACGCTCTTCATCC
ACATCGTATGCTACGCTCGGAAGGAAAGGGAGAGGGGAAGGAAGTTCTCTACTGCCGCTGCCGCCCGACGTCTGGCTTCTTCGCGGTTTCGAATGAGGGA
GTGTGACTGAGCTGCCACGAAGCCGACGCATCAATGAATACCCGCCCAAGTCGATGGCGGATAAGAGGAAACCTTCCAGAAACACATGCGGACAGTGGGA
GAAGGGGCGCGCACGGTAAGCAGCCATTATTGGACAAAAATGAGACGAATCAGGTCGCGACACGACCTCGAACGAATCATATGTGGCCACACTAAATGAT
CATTTAACACACAAATCCTCTCATTTCCGTT