Description :
From Genome Similarity Track
Location :
Scaffold_51:153941- 155286
Transcript NameFunction/comments
Phypa_INRA-310PPTG_15703pectin lyase

Sequence
1345 bases(100 bases per row)
TGCCAGGAGTGTAGTCCTGCTGCTCCGTCTGCTCCGCCGAGTCGCTTGATTGAGTGGTCTGTTGCTGCTGCTCTGAGTCGCTTGTCTGAGCAGAGCTCGA
CGTGTAGCCAACAAAGGTAAGGATCGTCTTAATGGTCTCGAGAGCAGTCTCACCGTTACGAGATGAGAAGTTGCCGCTGCTGACGAGCTCATTAGCCACG
CACGAGCGACCGAGGAGGCTGCTGCACTGGTCGTCGCTACTGGCGGCGTACAGAGCACCTTCTTCGTCCTTGTTGTACAGAGGCATCCTGGTGTTGGTGA
AGTAGTTGCCCTCGGCAAGAACCCAAGCGTTCGAGCCAATCTCGAAAGAGTGACCAGAGTTGTTACCCCAGCAGTTGTTGGCGACGTGGGCGACAACCTT
CGCAGCGCTGTCACCGCCAATCTTAGGAGAACGACCAGAAGTGCCGTGGATGTAGTTGTTCAGCATACTGAACTTCGTCACACCGTAGAAGATGAACGAC
CAGTAATGGTGACCGTCGCACGAAGCCGAGTAGTCCGTGTTGCCGTCGAAGTCGGAGTTACTGATGGTCATCGAGTCGGTACTGGCCTTGTAGGTAGTGA
TGAACTGACGACCAACGCGAGAGATCTTGATGTGGTCGAGCCAAATATTTTTCATAGGCGTGGTGCTGTTATCGGTACCTTGAATGTAGATGGCATCTCC
ACCCCAAACGAGGTGGTGGTTGAGCTCCGTGATGTGGATGTTCTGTACGATGATGTTGTGGCCGTTGAGTGTCATGCCCTTGCCCATGATAACACCGCTT
TTGCCAATGCCACGGATAGTCTTGTCGCCCTTAACAGTCATACGCTTCAGAGCTGCCCTGTCGTACGTTACCGTCGTCTCCGTACCGTTGTCACAGCCAC
CGGTGTTCGCCATACCGCCCTTCTGAAGAATCACATCTTGGCTCTTAAAGCCGTTGTTCTTGGCAATACATTCACGAGTGTACTGGGGACGACAGCCAGG
TTCGGTGGTCGTTCCCTCGGTTCCACGGAAGTCGAAGGTCTTGTTCAGTACAACCACCAGTGGCTCTGAAGAGTTGAGATAAGTGATCAGCTCTTCATTC
GTGGTAGGGTATACGACGGTGCCATTGCCTCCACCGGTGGTGCCGGCAGCAAGACCTTCGGGTGTACCGATAGTGAAGGCGCTTGCACTCTTAGCGACGA
GGGCCAATGCAGCTGTCAAAGCGAAGTGGATGCGTCCCATACTTCAAAAGGTGGAGAGGTCTTGAGAAAGTGTAGTGCTCAAGGCGAGGCAAATTTGAGA
ATGACCGTTTGCTAACATTAGTTGATCGAGTTCGAGCCCACTGTA