Description :
From Genome Similarity Track
Location :
Scaffold_567:1539- 7367
Sequence
5828 bases(100 bases per row)
GTTCATCGCGAAGGGAAGCCGCTCTGCGTACTCATCCCAATCCTTCTGATCCAAATCCTGGACATACATCTTGAGTGCTCTCGTGATTGTCTGCACCATG
CGCTCGGCCGATCCGTTAGCTTGGGGACGATATGCCATGGTTGCTCGCTGTCGCTGCCCCAGGATCCGGTTGAATGCTCGAAAGAAATCGGACATAAAGC
CTGGCTCCCGATCATGCCTAATCATCTCGCTAGCTCCAAATCTTCGGAAAACGCACTCCTCGTACGATTCAGCAATGGTTTGCGCAGTTCTAGACGCACT
AGCTTTGGCTATCACGTATCCGGTAAACAGGTCCACCCAAATCAACAATTCTGTGTTTCCTTTGAACGACTTGGGCAACGAGGGGATATGATCCATGGCT
ATGATTTGGAAAGGGTAAGTCGCTTGGATATTCCCAGGTGACTCCCCTTCGATTGTGGGCCTGCCCTTGCCTATCTCACAATCCACGCATTCACCGACGT
ATCGTTGTACGCTCTTGAATAGTCCTCTCCAGTGGAAACATTCCCGGATCCGTTGGTAGGTCCGACCAATACCCTGATGTCCGCCTTCCAGGCTAGCATG
GTAGTGGTGTAGGACATCCTGTTGCAAGGTTTCTGGCATCACCAGTCTCATCAAATCCATCCCGGTCCTCGTTGACTCTCTTCGTAGGGGGGCAATAGAA
GAGCAAGTCATTCAGATCCACTGCGTAATCCGTAGCGATAATACTGTAGGATTTGGTATCCTCCCGACTCAGGTCTCGTACATCCCCCATCAGATACTTC
TTTAGTCCCAGGATCCACGCTTCCTCGTTCTGTGCTTTGAGGATCCGCTCAATGCGGACTCTCTTCACAAATGTTTCCTCGAGAATTTGGGGGTTGGATC
GAATCCTTCCTCTGGACCTAGTGACGGCCATCACCTGGACTGTCCTTTTCCCGGATCCAACTACCACCACTTCGTCTAGTCGGTTCAACGTAACGGGATC
CTGATGCTCGGCCTCTCTCTCCAATTCAACACCACATTGATTCCGTAAAGCGGCGCTGGCCAAGCTATCTGCACTGGCATTCCAATCTCGCTTGACATGC
ACCAACTCGTGATTCATCCAACCGCGCAGGTGGATCATCACTTTCTGCCGTAACAGTGTTAGGGCCGAGGCCTTGCAGTCAATCTCGCCTCGCACCTGTC
TGATTACCAAATTTGAATCCCCACAAATCACCAACCTTTTCGGATCTTGTCCCTTTAGTAAATCCAAACCCAGAAGGAGTCCGTTATACTCCGCCTCATT
GACGGTGAGGCCTTCCGCGTAAGTGGATCTGGCCCGTACAACTTCCCATCCGGGCAGTCTCCACAGTATTGCACTGTATGCTCCCCCTCCGCGTCGTACA
CGAGCGGATCCATCGAAACTCAGGACGTATAGATCCTCATCCACCTGTACCGTCGGGATCGGGATCTGGATCCGGCGTTTGGGCTCTTTCTTAGGAGCGA
CCTTAGTCAGCGCTTCATCCATCTTAGCTCGAGGTGTGATGCTCACGGCCAAGCCTCCCAGGATCTCGTCTTCCCCTTTCGAACATTTCACAATCTCCAG
TGTCCAAGGCGAGAGTAGAGCTGCCCACTGTCCCAAACGTCCTTGTAACCCGGCCGACTTGAACAGCCAGGCTAGCGTAGAGTGTCGGGTCAGGATCCGG
ATGGATCTTCCCACCAGCAGGTTGTAATTCAGGTCCAACACGCGCAGGAACGCGAGTATCTCTTTCTCCACTGCTCCGTAGTTCAGTTCATTCGGCTTCA
GTGTCCGGCTGACGAAGGTGACTGGATGACAGATCCCCTCATGTTCTTGTACCAGAGCCGCTGAGATTGCCCAGTCACTGGCATAAACTATCACCGTAGG
TTGACGTTCCGGATCGAAATGACGGAGGATAGGCGTGGTCGCGATCCTGTTCCTCAGTTCCACGAATGCGTGTTGAGCTCGGATCCACCGAGATTCTGCC
TTTTCCATGTTCCGATCCGTCGTTTCTATCCAGACTGGATCCTCTCTCCATTGGTCCCGGGGTAGATCCAGCTCCTGTTTTAAGTCCTCTTCTGTCGTCG
TACCACTTGGATCCCTTCGTGGATCCGACATATCCCGGGCCAGAGCTTGTTGGATTTTTATCCGGACAGCTGGAGTGGTCATCGCGGCAAAATCTACCTC
TCTCAATTCGTACAATACCGCGGCAAACAGGGCGTAATCCTCGATGAACCGACTGTAGTAGTTCAAACTTCCCAAGAAAGATTGCATCGCCCGTAACGAC
TGTGGGAAGGACAAATCGGCTAATGAAGACAGGTCCTTAGGATTCGCCTCCAATCCCTCCTTGGAAAATCGATGGCCTAAGTACTCCACCTTACGCATCC
CCCAATAGCTCTTTACCACACTGATAGAGAGATTCCACTTAGTACACGCCTCCAGTAGGGATGTCAATCTTTCGCACAACTGATCCCATGATTCCGCCGG
GATCAGAATGTTGTCGATGTAAGATCTGCGTCCTAACACAGATGGGGTCCCAGGATCCCCTGGCTCCCCCGCTTCGAATGGATCAACTTCCGTATGGCCT
TCCCCAGACCCACCTGTTTCGGACTCCGGTATTCGGGTGAATCCATAGAGGGCGTTATCGATCAGACGTTGGTAGATCTGGGGTGCGTTCTTCAATCCGA
ACGGCATCCGGTTCCACTCGAACAGGCCAAACGGTGTGATGAATGCGGATATTGCGCGATCCACGTACTAGTGCGGCGAAGCTTGGATTCCAGCTCCGTT
TGCGTACGCTTGGCATCCGCCCACTCGGTAGCCGCCTTGTCCCGCTGGAATTAGCTGTCCGCCAGCTTCGCTTGGATTTCGTCGCGCAATTGCGTTATAC
GCACGAACTCTTCAAGCGCGTAATCTCGTCCGGCAGACGCCCTCTCGAGCGACTCCTTGGTGTCTTGCAACTCCTCAGAGAGTTGAGCCAGGGCTACATC
CGGCGATGAGGGAGGTGGATTTGGCGCGGGGGACCCTCCACGCGCCGACCCTAAGGCGGATCCACCATGGGTGGATCCCACATAGTCGTTGGCTAGAACC
CGCAGATCCGTGGGCGACATAGAAGACGGACTGACCGGAGGGGTAGTGGATGGGGCCTTGCCCGACGATTTGCCGGTACGCTTGGCGGGAGACATGTGTC
GCGAAGGGGAGAAAGCGGTTGTGGATGCTGGTAATGCACGCCGTGAACGCTGTTGTGCAGCGCCGACAACGTACAGGAGGCGATTGTGGTGAAGTGCTTT
TCCAGAACTAAGAGAATGGGCCTGACGCGGAGTCACTATCCCGAATCAGTGACAATTTCAAGTGATTAGAGAGGATTTGGGTTGGCTGGCACGGATGCAA
GTTGCCTGTGGTGGATTAGCCATGGCGAGCAGCACCCCGTATGGAATGACGATGGATCCGATATGAGCGACGTACGAGAAGGCAAGATCCACCAAGACTT
ACCTCGGATCCACCCTTACCTGGATTCACTAAGATGGATATGGGATATACTATACAAGAGTGGATCGAGTGTGGGATCCCTATGAAGGAAGGATGGTCGG
GGCCCTCTGAAGGGGAATCTAAATCCACGGCTAATGAAGAGTGCAAGATCCACGGGGGAGGACCCCCGGATCCATCTTTCCGAGTTTCGGATCCACGGAG
GGGAGGTGCCGCCTGGGGAGGGTGCTGGATGCGGGGGGGATAGGGATGAAGGACGACCGGGGCATGCTCAGAAGGTCGTGCGGGATCAGGGCTGAGCCGC
GACGCATTTGGATGTGAGCTAGTGGACAAATCGCAAAGATCGGGATCCCGCGTGCCGAGGGTGCAGATATTAGGGGAGGGAGTTCCCTCGGCATGGCGGA
CGTCAGATAGAAAGGTACCATCGGGCAGGGCGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCGAACGTTCGTGGGACAATGGAGATCACAGACGGTTGCGAGATGATGTTGGATGATTGGAGAGCTC
GGATCCACGGCAAATGTACAATTACAGTGAGGTGGATCCAAGCAACCTGGATCCGGATAAGTGTACCCATAATAGGGTGACCATGATGATTACGTCATGG
ATCCGGTGGATCTGAAGATAGCACAGCTGGGATGATGGGTCAAGGGAAGAAGGGACATGCAGCCGAGCCTGGTAAGGGATTTAGCAGATGAAAGACATAG
AAGGTAGAAATCCAGGCAGGTATAGGCTTAAAATATCAATACAGAACCCAATTTGCACAGTATCACGCAAGTGCCTTCCTGCCCTCAAGAACCGAAACTA
CATTGGCCGTACGAGCTAGGAGAAGGTTGGGAATTGCGAATCTAGTGTTGGTAGTGATAACTGGATAATACATTGGCCAGATCCTACAACCTAGTGAGCT
TTTCCTTTACTTGTGCAGATCCGACAGGTTAACCGAATTTACTACTTGGTCGGTTACACCCTAGAGGTTCTCAACTCTCAAGATCCCGTCACAGGAGGCG
GCAAGTACGACGCAAAGGAACTACAAAGGCAAGGGAACACACCCGCAAGGCAACCCTACGGCCAGATCCACGATCTAGGCCCCGAATCCATAAGCTCGAA
TATTCGCTTAGGATACGGAACCATCCACGGACGCAGAGTGAAGATTTTCCACTGCTGCTCCACCCCATCCCCACGTCTCGCCAAGACGCTCAAGCTTCAC
CACTTGAACTCTTCGGAAGTTACCGAGAGAGCAAGATCCCGCCCTACCGACGGGTACACAAGGTGAGGAAAGTTTAGCAGAACACGGATCATCGGGGGAC
CCCCTCCGTTAGTCGGTGCCTGGGTGCAGTTGGTAAGCTGGATCCGGCAATCTCGCAGATTTTGCTGATCCCGCTACACCACACCGACGAGTTCCCGGAG
TGGGCATAACCCCTTCACTTCACGAGGAGCTGGCGCTTTCCGCAAAGCCGCTGCTTCTGGAGAACTCGCCATACATGCCTCCGCCCTCGTACGAGTACGG
GTACTAGGCACCTCCGAAGCGCTACTCTCATCCGGGTGCCCGCCGGTGGGCCCAACGCAGGGCCCTGAGGTTGACCACCTCAGTCAACGAGTCCTCGTGC
TTGAGATTGTACTTGGCCTTGGGACCGGCGGTGATGCTGCCGCCCAGGCCGGAAATCAGAGCGTGCTCGCTCGTCTTGCGGGCTGCCTGAACCAGTAGGA
GCGGGAGATCATGAGCCTGCATCAGTGGGTGGACCGCCGGGCCTCTTCGTCCGATCTCGACGAGGCCTTCCGCATGATTCGACGTATTTAGGTTCTGCTA
CCACGTCCGGAGCTGTAATGGGCCTACTTAAAGCCCACTACTTCGGCTTACACGTTAGCGCACGTGTATGAGGAAGCGTAGGTTGCGTTTCACTAAGATT
AGCTATACTTTCGTCCGAAAGTATATACTTTTTTAGATTTACTTAAATAGGAACCAAATCCGATTTCTGGTAACAATAGGCACTGTTTATTTGTTTGTTT
GAGTTATCCTCCTAATCTAATATTCTAAATAAAAGGTATTTATCAACGAAAGGTTGAAATAATCCTACTATTCTAATTGGTGGAAGATATTGACTTTCAA
CCAATGAATGTCCCAAATGCTTGCAGTCTACCAGATGTAACCATTGGTGCATCTCACACCAACGTTGAGAACCTCTTTCGTAACCTAGTGGCTACATGGA
TCCACTTGCGTGTAACCCCGTTACCCCC