Description :
From Genome Similarity Track
Location :
Scaffold_1940:1539- 5561
Transcript NameFunction/comments
Phypl_g14428hypothetical protein PHYSODRAFT_564322
Phypl_g14429conserved hypothetical protein
Phypl_g14430hypothetical protein PHYSODRAFT_258942

Sequence
4022 bases(100 bases per row)
AATTTTGGTTAATGATCAGTACCTGCGCTCAATGTGTAATCACCTCCTTTCTTTTTCTCCGAGCGCACTTCGCCACCCGCTCGTGACTCAACGACCGACA
CCAATGTATCCTGAAGCACCAACGATTGCGGTAAGGGTGATCATCGTGTACTACGTGTAGCTTGCGTCATAATCTGACAAGTACCCTCCTTGGTGACGCC
TTTTCTGGTTGTAGGAACAATTTGGGTTTGGCGACATCGCGTCGGCCTCGCCATTGTCAACGTCACTTTCAGTAACGTGGCAGAAGGTGAAATCTATTGG
AAAGGCGACGTGGGCCCGGAATTTGTTCGAAAAGGCTGGGCTACGGCGTAGACGGGATGATGGGGAAGAGAACCACAGTGTTAGTGGCGCTGCTCAGCTG
CAAAATACCTCCAAACAAGCGCGTCAAATTGCAGCAAGCGGGGTTGCTGATGCTAAAAAGCCATCTTCCACTACGGTTCAGCGTGCAGCAAccatgaagc
tgtcgagaAGCTCTGATCCTTTCATTTTGGAGAACATCAAGGCACTGTCGTGTCTGTGCGGCACATTCCTTTTCCGATGGGGAACTGATGGTGGAAAACG
GCAGTCCTACGCAATGCGTCTGCTCAACACGTTAGCTTTCCACCATGTTGAGGTTGTCGAAAGCGAAGGGGGAACGGTGGAGAACGTCTCTCTGGTCCAT
ATGCTGTGGTGTGTCTTGCAAGACACGAGAAATTTTGAGGACTTCGCCAAGGTAACCGTATTCTCTGTTTTGCTGTTGTATGGTGTGGAGCTGACTAACA
ACGCGATACATGACAGAATGTGGATTTGATCCATGCGCGCAGTTCAGATCCGTATGTGTGCATGTTGGTGCTGTTTTGTATGTCATACGAACATCTTCTG
ATCGTAatggacgatgaagaggtGAGCTTTTGGGTTGCATCGTCATAGTAAAGTCTGCCTTTAATTCAGCGATACACTAACTTTGTTGTGATGCCCCGAA
GATGTACGAACAAGAGTACCCTCTCCCTCTTTGCCAGATCGAGCGGATTGTTCTAAGTCTGAAGCATGCACTCCACGAGGCATATTGGACCCACGCCAAT
CTCGCCCCGTCTTCCGAATCAGTTGCGTTTGGCATGTTCGTTGTCGAAATGGCGACTCGTTTGATGAGGGTTCTATACAATCGATGCTCTCGCCAACCTT
TTTGCAATGTCACGAGCTGGTACGTTGTTGCTAGGAAATATTCAATGTCACACCTGACAACTAATACCGGGGTTGGTCAATATGTTGCAGGATCATTGCC
GAGCTTGATAGCAACCAGTTGATTGAAGAAGTTTTGACGGGCACACCCCGAGCCAACAAGCTAATCCAGTCGATGCCATACCTTGTTCCGTTCCCCGATC
GCGTAAAACTGTTTCAACGTCTCGTCAAGGCCGACAAGGAAAGCCACCAGAACGAAAGATGCTCGGTGTACCGCATCCGTATTCGTCGCGGTGCCATTCT
GGAAGACGGTTTGAGGAAGCTGAACTCAATTCGAACGAGCTTGAAGAAGCGCATTAACGTGGTGTTCGTGAACTCGGCTGGTCGCGAGGAAGTGGGCATC
GATGCCGGCGGACTCTTCAAAGAGTTTTGGTTGGACCTGTCGACGCTTGCATTTGATCTGCAGTATGGACTTTTCCTCACGACCCACGATCAACTGCTGT
ATCCTAACCCCAATTCAGCCTCGAGTCATTTTTCGCGTGAGAGCGACCACTTGACGATGTTCCAGTTCGTGGGCCGAATCCTGGGAAAAGCTCTGTATGA
AGGCATCGTGGTTCAGCCGAAATTCGCCCACTTCTTCCTTTCCAAGCTTCTGCATTCGTTCAATCAGCTAAAtgagctgccgtcgctggatCCCGAGATT
TACAAGGTGACGCTTGCTTGACTTACAGCTCTTTAATGGCTTTTGTACTAATAGTGCTCTCTGTTGTGCAGAATCTGATGTTCCTCAAGTCGTATGatgg
cgacgtggaggaccTTGGCCTGACGCACACGGTTGTCCAAGATATGTTCGGCGAGCAGAAAGAGATTGAGATTATCCCGGGTGGTGGCAACGTACCCGTG
ACGAGCCGAAACAAGACGCGGTACATCCATCTTGTTGCCAACTACTACCTCAACACTCAGATCCGTGAACAGTGCGCAGCCTTCCGTGTGGGGTTGTCAG
ATCTCATCGACCCCCGCTGGCTTCAAATGTTCAACGAGCCcgagctgcaagtgctgaTTTCGGGCAAGAGCGGCAAGATCGACATTGACGACCTCAAGGT
CAACTCCCGATACGCCGGTGGCTACTACGCATTGGACAAACGCGTCGCGTGGCTGTGGCAAGCGCTGGCGAGTTTCACGCCCTCCGAGCAGGCTGCGTTT
CTGCGCTTcaccacgagctgccagCGCGCGCCATCGCTGGGCTTCGCGTCGCTCACGCCCCAGTTTTGCGTGCAAAAGATCCCCATCcgaagcgacgacg
agctgctgccgagctcctcgacgtgCTTcaacacgctcaagctgcccACCTACTCGTCGTACAAGGTGCTTCGCGCGAAGGTGCTTACGTCCATCTCTTC
CGGCGCCGGCTTTGAGATGACCTAGGGCTCCGTGTCATTTTCCCCGTACCTACTACCACTaacgacttcaacttcaacattTGATCACAAATCACAAAAC
GTCACAAAATCAGAGTCTCCATACGGACCACATCAcagttcgagcagctccattAGACCTTCGACCATCATGGGCAGCGCCCAGGATGAGATCCGACGGC
TgatgaaggaggccaagcagaagcccagcgccgcctctgCATCTCGCCCGAAGACGGCGCCCCTCAAGGCAAAGCCATCTGCCGCAAAGCCcaacagctc
caccgccagccACGCACAGAAGCCAGCGATCCCCGCGggcttcttcgacgactcgttggccgacgccaaggccCGCAACGTGGACGTGCATCAGCtggcg
gagaagcagctcgagtccGAGTGGGAGGCGTTCCAGGAGTTcgcggccgaggtggagcagcaatccgccaaggaggagaaggagcaggtggcggagaccg
aggagcgcgaggccgtcgagcagctcgagaacaTGCAGTACGTGGACAGGTtccgcgtggcgctggagcgtGCAACCAGGCTCCGCAACGGAGAGAAGCA
GTCTAAGGCAgagaagcggaagcgggGCGACGTGGTtggagaagacggcgaggcAGAAGGCGCCAGTGGCGTCAAAACGGCGCTGAACGAatacaagaag
aagcacaagaaggtcaagaaACAGCACACGGGCAGTGAAGACTCAGACGAGGACTTCGACCCGTGCAACTGGAGGTCTCGGGCCATCTAGACTGATAGAG
ATAGGGGCGACACGACATGGCAATGGGCTCATCAAACATGTTTAATGGGAAAGTTGCGCGCTTGAATGGCTCTCTCCTCTAATGGATGGCAGCGCTTTAG
ACAAGGTTCACGNATGGCGTACAGGATCACGCCGCACCCAATCATCAGCACCGGCGTGTCCATCGTGTGCGGAGCAGTCGCCTCCGCGTACGCCATCGTC
GGCGCCAGGAtcagcatcgccagcagcacctgccaGAAGTTGTCGAACGCGGCGTACTGCAGAGCCGGGAACACCAGGCCAGACAGGAACACGCACGCGC
TGCCCTCCCAGCTACGCGTGTACTTGTtcttggagaagcagctgcgcgtcTTGTACTTGTGGCGGCCCCACGTGATGCCCACAGGCTCCGCCAGACCGTC
GCCGATGCCCGTGATGAACACGAGGATGAACGTCAGCGCTCCCTGCGCGGCGAACAGCCACTTGAAGAACATGAGGATGAACATGCCCGGGGCGATGTTG
CCCACGATGATCCACTTGAGCGTGTTCGGGCGGTCCTCCGGACGGTCCAGCGAGTTGAACTGCAGCATGAAGAACTTGGAGTGCTCGCGGACGGGCTTGA
TGAGCACGAGGAAGCCCAGCAT