Description :
From Genome Similarity Track
Location :
Scaffold_28:153833- 157042
Transcript NameFunction/comments
Phyra_4638030S ribosomal protein S16, putative
Phyra_77997nucleolar protein, putative

Sequence
3209 bases(100 bases per row)
ATGGTGGTGAGACTGCGCCTCGCCCGCTGGGGACGTAAGGACCTGCCCTTCTACCGCATCGTGGCCGCGGACGCACGCGCCCCGCGCGACGGCAAGCACC
TCGAGATCGTACGTGTTGCAATTTCCACTTTTTGCGCAAATTAGTGTCAGCTAACCTTTTGCGCAACTTTTTCACCAGCTCGGCACGTTCAACCCGATCG
CCGCCAGCGACGGCGTCAAGGAGCTGCGCGTCAACAACCAGCGCGTGCGCTACTGGATGTCGGTGGGCGCACAGCCCTCGGACCGCGTGGCGCACCTGCT
GGGTCTGGCCAACGTGCTGCCCCTGCCGCCCACGCGCCAATACACCAAGAAGTGCGTGCCCAAGAAGGACCGCGAATAGAGCAGAGCAGAGATGATTCAA
CACTTTCGCACAAAAACTCCTTTGCGCTTTTGCGCTGTCGCGCAAAACGAGACTTGCATGAAAAAGGCAACTTGTATTTGCTAATGCAACTGCAAATTTG
CAGTCTACTTCTTGGGCATTCGCGCACGGGGCGCAGGACCCCGCGCGGAGCCGCCGCCCTTGAGCATGTTGCCGCCTTTGCGCACCTGCTGGTTGAACGT
GGCGTTCTGCTCCTCGAGCCAGCGTCGCACCTCCTTCTGCTTCTCCTCCTTGGCCGCGAGTCGCGCCTCCTCCTCCTGCTGCTTCTCGCGGTGGATGAAC
TCGGCGTCGCGCCGCAATTCGCGCGCCGCACCCTTGCGCGCGCGCTTGACTTGGCGCTGCAACTGCTTGAGCTGCGCCGTGTCCTTGGGCAGCGTCTTGT
CCTTGCGCACCGTGTAGTTCTCGTCGAAGTGCGGCGCAAAAGTCGGCAGCGTCGTTGGCGCAAAACTTTGCAGGCGCAACGGCCGCCGCGCCGTCCAGCA
GCACTCGAGCCGGGTGTGCAACTTTGCGATGATCACGTTCACGTGCGAAATCGTGACGTTATCCAGCTGACGCACCAACGCGTGCAACAGCAGGTAGAGC
GGGTAGAACAGCTCGTCGAACGACGGTAGGGCGGCGTACTGGGTCGACGCAGCCTCCAGTAGAACCAACAGCCCTCCAAGCACCTGAGCTCCACTGCACG
ACGAACTACCTGCCAGTTGCAGACGCGGTAGAGCGAGCACCTTCTCATGGCCGTTGGTTGCTACCCACTCCAGTAGCTCACGACGCAGCCAGTGGACCGA
CGACTTGTCCTTTGATTCGTCACCCGACGTCACGAAGGCGCGCAGAAGACGCGTGAGGAAGCTCACGACCTCCGGCATGAAGCGCTGCTTCGAGCGCGTC
ATGTCGAGTGACAGCGACGCGGCGAACAGCGCCTGGGCAGCCTCCTGCGGAGAGTCCACTGCGCCACGAGCCAAGCTCTCTCCTAGCAGCGTCTCCATGG
GAGACACGACGTTGTGCCGCAAGTCGGAGGTGGGGAAAATGGACGTCAACGCCTTGAACAGCAGCAGCTCCGGCAGCGTCGGCCACGCGGACGTCGACGC
GCGCTTGTGCAGCCGCTTGAAGAGCTGCGCCAGCAGCTCACGCGCCACGATCCCCGCAGTGTCGCCCATCTGCTGAGCCAGCGTGTACATGCTCGTTGTG
AGCGAGTCGAGCTGCAGCAAAGCGAATACAAGTCAGCATTAGAAGCCACGCCAATGGGAGGAGGTTGAGGGGACACGTACGTCTTGCTTGTGGGCCGCGT
AGCGCGCTGCGAAGACGAGGAACTGGCGCACCAACACCGCGAAGAAGCGCTTCATCAGCTTCTGGTTCTCCGCGCTCAGGCGCGGGTTGTAGTACGCCAC
GAGGCGCTCCAAGATGAGGCCACGCTTCTCGGGCGAGTTGCGCGCGTGCTTCTTGAAGAGCGCTCCCAGCTCCTCCGGGGACTCGGGGCACTCGAACACA
AACGGCAGCTCGGCGGCCGCATCCTCAGCATCCTGCAATTTCTTCTGCTTCTCGGCGTCTTCATCGTCAGCGTCTTCCTCCTCCTCCTTCTCCTCTTCCT
TCTCCTTGGCCTCATCTTCATCGTCCGAGTCCGCCTCCGAGTCCGCTTCCGAGTCTTCCTCGTCGTCGCTGTCCTCCTGCTCTTCGTCTTCATCTCCAAC
GTCGACATCCGCCTCGGCTTCTTCCTCTGCATCTTCCGCGAACCGGGAGTCAACCGCGTAGCCGTCCGTCAGGTCGTCGTCCGTGGGGGGCATGATGATG
AGCTTGGGCGCTTTGTCCTTCTTGGCTTTCTTCTTGCCCTTCCTGCCCTTGCGCTTTCCGTCATCGTCACTGTCACTGTCCTCGTCCGCGCCGTGCATGC
GGGCCACGCGCTTCTTCTCCAGCTCAGCAAGACGGTCGTGCTCTTTGGCCGCCGCCTCCTCGGGCGACATGCGGCGCTCCGTGGCCTTGGCCTTGGCCTC
AAAGGCGAACTCGCGCGTGAGCTTGTCGAAGTCGTCCATGGGCTGCTTGGGCAGCACTTCCTTGCCGTTCGCGCGCGTCGGGCGGAAGTCGAGCAGGCCG
AGCAGGTCCGCGAAGCCCTCGTCCAGCTTGTCCGTGGCGTCCTCCTGCGACGACTTGTTCTTCTGGCGCTCGGCCTTGTACAGCTTGGCCTTCATCATGA
CCTCCTGCATCACTTCCTTGTGCGTCTTCCTCTTGCCCTCTTCGTCCTTCTCGGGCGCGGCAGCGTCTCCCTTGCCGCCTCCGAAGTGGAGTTTGTCCAC
AATGTCCCTGTCCATCTTCCTGCCTTCCTCCGAGTCGTCCTCTTCGTCCAGCGGGCCGTCCACATTGAGCCTATCATAGTCGTCGTCCGTGATCTTGGAG
CCTTGGTGCGTCAGGAAGAGCGCGTCGTCGTCGCCTTCCTGCTCTGAGTCCGAGTCGTGCAGCGCAAAGGCCGACGCGTTGCGCAGCTTGCGCTTGCGCT
CCGTCTGGAAGCGCGCCATCATCTTGTCCTCCATGGACAGGGTCGGGTCCTGCTCGCCGAGCCGCTTGTCCTTGAACACGTTGCTCTTGTTGCGCGCGCG
GAACTCGGCGCCGAGCGTTTTGCGGCGCTTGCGTTCGGCCTCGGCGCGCGCGGCCGCCACGTTGCGCCCCGCGCCCTTGACACGCCGTCCGATCACCGCG
TGCTTCTGCTTGGCCGCATTGCCGCGGACGTCGAACGGATTGGCACCGCGCGCGCTGCTGGCGTGCACGAAGCCGTGCTTCTGCTTTTTGGTGGAGGAGA
CCTTCTTCG