Description :
From Genome Similarity Track
Location :
Scaffold_212:15379- 22355
Transcript NameFunction/comments
Phypl_g5342hypothetical protein PHYSODRAFT_328596
Phypl_g5343hypothetical protein PHYSODRAFT_328597
Phypl_g5344hypothetical protein PHYSODRAFT_328597
Phypl_g5345anaphase-promoting complex subunit 10
Phypl_g5346AlNc14C135G7072
Phypl_g5347Rio kinase

Sequence
6976 bases(100 bases per row)
tccaccgtcCCCTTGTGGACGTCTGCAAATTTGATGCGAACAGGTCGCGACGCGCtcttcagcttggccacgacctccttgTACGTCAGTCCAGCGAGCG
ACGTGTCTTCGATGCTGATGACGCGCATGCCGATCGTCAGGCGCTTGTGCGGCTTGACGCTCCAGTTGTGGAGCTCTGCGGGGCCGGCCTTGCCACTGAT
TTTGGGCAggtcgtccacctcggcctGGAACTGCGGGTACAGGATGGTCTCCATCTGATGGACCTCCCGTAGGCTCACGCCGAGCCGCCCCTCCTGGAAA
CAGATCTCCACCTCGCTCGTCCAATTgaacgtcttcttggtcttggcgcTCGACGTCTTCATGGGGGGCGGCACCCACTGCGTTTTGCCGGCGGGGGAGA
TGAAGTAGTAGCGGCCCTTCTGCGACTTGCTCTCCTTGCGCGTCCAGCCGGGCGGGAGCTTGTCCTCGCCCtcgggcgtggcgctgccggtgctgcgtct
gctgccgCGACTGCCGCGACTCCCGCGGCTGCTGTTGAGCGGCGTGGCATTGGACGAATTGCCACTGCTACTTGCTGTTTTAGCCGACTTGCCAGTGGTT
GCCGTGCTTGTCGTACCACTGCCGCCCTTGTCGCTCGTGGACATGGTGCTGTTGTTTCTGGAAAAAATAAGCCATCACGGCCAACAGAGTTTAGTACCTC
GCTTGGAAAAAGTGGCGCCCCTGTCGCTTTAAACACTAGCCTAAAAATCAGGTACGCGTCGATAAACAACCCCCCTCACCTCCACAacgtcgccttcttc
atggaTACGAAGGGACCCCCCCCGAGCTCTAGCTAGCGCGGCGCAGACAGCGTCAGGGCGTacgtggtcgtcgtccgctgTGCTTCCTCCCTGCCTCACA
GGAGATCGCGCCgtcgctcgctcgcgctcggcagctCCGTTCCTTTCTCTCGCGCCTGGTAAAATGGCAACCCCCTCCTCAGTCAGCCCTAAACCAGCTG
GTGGAACCGGAGCTCCATGGATAAGTACGAATTGTATTAGCCAATCAAAACACGCGCCCCATCTGATAAATCTGAGGCGAAGCCATCTCAGCAGTCGCGC
AACGTTGTCGAAGCTTCAGTAATAGGATTGAAGTTGCCGCTCGAAGGACGGCGCTCGAGCGCGTTTCCGCGGCGAGAagtcctcgacgtcgtccgtGGAT
CGGTAGACGCTTCGAGACCGGTTGAGACGGGGGTCGCGTGACGAGATGCGGCCCTCAGCCAGCTGGAacacgctgcgcgagcgcttgcgGTActcggtgg
ctgctgctgcactcgaggagtgctgctggtcgcggAACGCGTAGGCTGGCGGCTGacctggcggcggcggaggcacaaactcctgctgctgtgggtgGTA
GTTGCGCCCCACACTCTCGGACACCTCGTAGTCGCCGTGGCTCCGCGGCGCTGTTGTCGCTGACGTCGAGCCCCCGTACGCCGCACGCTCGCGGTTCACT
TCGTCGATATACGATTCGAGACAGTGCACCATGTACTGGTTCCTGTCGATCGTAGTCGCGCAAGAGAACTTCTTGTGCAGGTCGTGGGTCGTGCCGTTCT
CGATGTCGGCCTTCAGGTACCAGCAACGCTTCATGTGGTGCCCCACTTTCAGACAGTAGAAGCACGAGACGGGGCCAGTGTTGTCGAAGCGATCGTAGCT
GTCATACTTCTTCTCGTATCTGCTGCGTGACTTGCGCGGCGACTTGTCGAAGTGGTTAGAGGACGCGTACTTGTCGTAGCCCCTCACGGagtcgtccttg
tcgtaTGGATGATGCTTCTCGTAGTCGCTCCCCTCGTTCCTGTCATCGTCAGCCTTCGGACTCTTCGACGATCGAGGAGTATAAGCTTTGCCCGCTCGCT
CAGTCGGATACTTCTTGTTGCTATCGCGCGAGCGAGTGCTAGTTGTGGTCTTGCTTTTTGCTGAAGAAGTCGATAGTTCCCCCCTTGTCAAGTCCACAGT
GTTGTCAGCTCCAGTGGTCACATCAATGGGCGGCAGGACTACTTTGTTGAGATTCCCTGCTTTGCCGGTCGTTTTCGGCGCCTCCGCAGCTCGTTGCTCC
GCTGGTTTCCCCCCTTCCTTCTGAACCGGTTTGCTGGGCGGTTTGATCGTTAGTTTCTCCGCCGACGTGCTAGCTGGAATATCTACTGTCTTCTCGGTTG
GCTTGGCGGTAGTTTGAGCCATAGGTTTCACAGCGGCCGGCTTGTCGGCCAATTTATCTGGCAATTGGGCGACTTGCATGGCAAACGAGCTGttcgctga
gctgctggttgatCTCACTACTGCTGTGTTCGGAACACtggcagcgtcttcgtgcaTTCGTTCCCGTGTAGCAATGACTTTCTCCACAAGCTCCGCATAC
GGCACAAATGGCCGAACCCCCCTCCACGACGCCACCATTGGTCTCCAGACACTAGGAAGCGTTTGCGTCAGTGAAACTGAGCGAAACGCGTCCGTCAGCT
CGATCCCCGTTCCGAGCGCATATTGCTGCATGAGCATCTCCCACCGCGTGACGAACTCTTTCACAGACTCTCCTTTCTTGTCTCCAAGGCGGATGTGGTG
CAGCACTCGGTGCATCTCGTACACGTCGTGGGCTCCGGGGTTGCTGCGGTTGCCGTACAGGGCACAGAGCATCTTCCAGCTGTCGTAGATGTTCTTGTTC
AGGATCgcggcctccacgtccgggtgcaggaagcgctgcaagaTGCTCTTAGCCTCGGCGCTCTCCCCCAGGACGTCCCATCGGCTGAGTCGACCCTGCT
GCGTGGCAGTGCTGCGACCAATCGAAGCTTCCTCCTTGACAaccgactgctgctgttcgtcgtccacgtggaTCACGGGCGTGCGGGGCGGCACCTCCTC
CCCGTTGAACTTGAAGGTCTGACTGCCGTCGTAGCCGCGCACCATGACGTAGCCCAGCAGGTGGTAGCgcatgagctcgttctccacgcgcgcgcgccac
aCGCGGAAGTCCGTCGTGCCGTCGAAcacgcgcacgctgctgccggcgctggcctcCATCGTCTGCTCCGCGGCTTCTCTTGGGCAGCTGTGAGGGATCT
TCGCGGCAGTTGCGGGCTGGAGTTTCCTCTCGAGTGGTCGCAGGAGTGATAGACGAACGAAGGGGTCCCAAAACTGGCGAAAGCGCTCTATTTATGCGCC
ATCGGACGCCGGATTGCCCAAACCGGCGCCAGGTTGAAGACATTTGCGTCCTGGGATCTGCAAGTCTTGACCTGCCGCGCTGTAGAATCTACAGTGTAGA
TGAGAGTGCGAGCACCAACACGGTGGCAGTttgcagcacgcgctgcaagTCTCGCAGACCGACCTCGAACACCGATGCGACTGTTGGTGAAACTGAGTTG
GCAAGTGCGATGCGATGACTGCGAGCAACGACCTCGAGCTTGCAGACCGTAACCTTACACTTCGCATACTGGACACAAATTCAACTGCTCTGAAAAGCGC
ACGCACCACAATACTTTGACGTCCACGTACGGCAGTCTGGACATGAAGGAAAAGTCAATTGAAAACTTGACAGCAAAAATCAACTCACAGCTACTGAAGA
AACACATACCGAGCGCCAGGGCGGTGCTCGCCACGGCACTACAGCGACGAGCCCAAATGGCGCTCGAAAGAGGGAGAGCGGTGCCGCTTCCGCGGGGGGA
AGAAGACGTTCGGGTTGCTGCCACGAAAACAACTCGCGGACCTCGCAGCGCCATCGCGAAACACGGGAGATCGGGGCTGCTCGCTGATGGGTGCGCGCTA
CGAGAGCGCTGGGTCACGGAACGTTGTCGGGGCTTGTTGCGATTCATCTGGTGCTCTTCCTGGTTGAGATCAATTTCGCGCTCACCGTTGCCTCGGTGAC
GTACGCTTCAGGCATCGCTGCCGTGCGCTTCTCCGTGGGTAGGCACGAGTACTCGTTACGCACAGTCCTTGCCGAGGACGGCTCGCGAGCGCTCCTTGGT
CTGCTCTTCTCACGGGGTCGATACGACTTGGAGCTGTTGCGTTCCTCAGCAACTGCCTTCTCTTTCAGCTCCGCAGTTGGTATAAATGGTCTAGACCCAC
GCCAGGCCGCTATTGAAGGTCTCCATTTCCTGGGTAGTGCGTACAGAGAGATACGAGTCCGTCAACGCAGCCCCCGTCACTAGTTtgaactgctgcacca
ccatTTCCCATCGCGTTATAAACTCTGGCCGTCCTTTTCGCCGTACCACATGTGGATCAATGCTCGGTACTGTTCGAAGATAGCGGGCTCCCTGCCGCTT
CCGTACATGGCGCGCAGTGTGGCCCAAACATCGAACACGTTCTTGTTGAGCACAGCCGCCTCGACATGTTCGTCTAAGGAGTGCTGCACAATGTGCATGG
CCTCTGCGGCCTCTCTCATCGCTTCGAAGTGAGAAAGCCCAGCTGGACACTTGGGCGGCAAGTGCTCGCCTTGGTAGGTGAACGACTGGCTGCCGTCGTA
GTCCCGCACCTCAACGTACCCAAGCAGTCCACGACGTAGCAATTCATTCTCCACACGAGCCTGCCACACCAGGAAGTTGGTGGCGCCGTCGAAGACCTGG
GTATCAGTACCGTTCTCCATCAGGACCGTCCAATGCGTGGCAAAACGCAAAGTGACCTaacggcttcaacttgggctTTCAACGGCaattttcagccaat
cagcaATCGGAGCGATTTGCCATgacggacgctgctgctgatggcgaAGGCCGGCGCGAAGTGGGGGACGACGCCGTgtggtcgctgtcgtcggccaAGC
CTGGCAATGGCGTGGACCAGCTTCGGGACAGTGCGTGCTGCAGTATGCTGGGCTCGTAGCTAGAGGCTGACGCTAACGgctgcgtgtgtgtgtggcagAC
AATATGGACACGTACTGGCAGTCGGACGGCGTGCAGCCGCACCTGATCAACATCCAGTTCTCGCGCAAGATGGCGGTCAGAGAGGTGGCGCTGTACCTAG
ACtacaagctggacgagagctacacgcccaagaagatcgccatccgcagcggctccacggTGCACGACCTCAAGGAGatccacgtgcagcacatTTCGGA
GCCCAACGGCTGGATCTCCATGCCGCTGCACACGGACGAAGGGTCAGAGCAGGTGCGTTCGTTGGCGTCGGTGACACGGTTTGTATGCTTTTGCACTTGC
TGATgaggtgttgctgctgatactCGCTATTGCTTCTTCCCTCTGTAGGCCCCGCTGcgcacgttcttcttgcagATCGTGATCCTCGCCATGCACCAGA
ACGGACGCGACACGCACATCCGGCAGGTGAAGATCTACGCGCCGCGCGAGGCCAACGTCCTCGACTGGGCCATCCCGGAGGCCACCACGCCGCAGTTCGC
AGCGTACTCCTGCATCCGCTAGCGAGGGCCTCGTGTGGTGCCCCCCACTCGCTCTCACACCCAAGCGACACAGCACATGTACTGAGACGACAGAAGAAGC
GTGAGTGCAGAGCTCCAACTGCTTTGATTAAGCTAAATATGAAGCCCGACGACAACGGCGGCAaacggcgcgcggcgctcgtgtcgACGGGTGGGGTAGA
CTTGTCACGGGGttgctctctctctctctctctctcgtgCTTATGCTGACGGCGACGGTTCCCGGTAGTTCGTGTGCTGGGCCGCGTTCTTGAACCTGCA
AGCAGCATCGCCAGAGAGGCCAAGGCCGGTTAGTGAACACCCTTCGAGGCACTCGAATTCCGCCGTCTCTCTCGCTGCACGTACACGCCGTTGAAGATGC
GCGTCATGGAGGtgacctcctcgtccgtgcgcgccatcttctccacgttctgcgccagcagcgcgatggacgcgtgcagctccatcatctgcgccgccag
gTCCGCGTACGCctgcaccttctcctcgtccatcgTCGTTTTTTGGGAATGCTGCCCCTTATCCGGACATAACCGGACAGTATGTACCCATGTTCGACGT
CGGTTGGTTGCTGGTCACTCTCTCACTCCGTCAATCGCCCGCGCAATTACTTGCTTGTCACCTATTGCCAGCGCCatgaaggacgaggacgacttCCGCC
TGTCCAAGGCGGCCGAGAACCAGCTGacgcgcacgctgcgcaatGAGGAGAGCGGGCGCTCGCGCCACACGGGCCGCGACGACCGCGCCACGacggagca
ggtgctggacccACGCACGCGCATGATCCTGTACAAGATGCTGAACCACGGCATCGTGACGGAGATCAACGGCTGCCTGAGCACGGGCAAAGAGGCCAAC
GTGTACCACGCGCGGCTGCCCGACGGCCGCGAGGGCGCCATCAAGGTGTACAAGACGTCCATCCTGGTGTTCAAGGACCGCGAGAAGTACGTCTCGGGCG
AGTTCCGCTTCCGCCACGGCTACTCCAAGAGCAACCCGCGCAAGATGGTCAAGCTCTGggccgagaaggagatgcGCAACCTGCGCCGCCTCAAGGACTC
CGGCATCTACTGCCCGGCGCCCATTCTGCTGCGCTCGCACGTACTGCTCATGGACTTCATCGGCCACGACGGCTGGGCCGCCCCGCGCCTCAAAGACGCC
AAGATTAGCGACGGCCGCTACCGAGAGTGCTACCTCTACTGCATCAAGATGATGCGCACCATGTACCAGAAGTGCCGCCTGGTGCACGGCGACCTGAGCG
AGTACAACATCCTGTACTACCAGACCAAGCTCTACTTCATCGATGTGTCCCAGTCGgtggagcacgagcaccCGAGTGCCAACGACTTCCTGCGCAAGGA
TTGCCGCAACATTGCCGATTACTTCCGCAAGACCGGCGCGCTGAACCCCATGACGACGCAGGAACTGTTTGACTTCGTCACGGACCCGCGCAttgcggac
gaggacgtggacaAGCACCTCGAAGCTATTCAGCGAGTGATCGCTGATCGACCTGTGGAGCGCACCAAtgaggagc