Description :
From Genome Similarity Track
Location :
Scaffold_103:153766- 154976
Transcript NameFunction/comments
Hyaar_Emoy2809542protein kinase

Sequence
1210 bases(100 bases per row)
GAACATCAGCGCTTCACTACGTGCGCAGAATGGACTTGGGCCCTCCACGTCAACTCTCGATGGTAACAAGTGGTCAAAGTGGTGGTACCATGTAAAGATC
GCCGCATCACGCTGATACAATATCGTCGGGTAAAGACTGATCGCTTTCTGCGACCTCTTCTCAGTCCACGACTACGAATGCTCCATACGATCCAAAGACT
TTGACAGCTTCGACACCTACTCCATCCAATATCTAGCACAATGCCATGATCGAAGCAAGCCGTCGACGATCGATCGTGTCGACTTTCTAACCTTATACAT
TTGTGCTTCAAATGAGGCGAGCGCGCGACCGAGCAAAGGTCCTTTCATCCACTCTACCGTACGTTTTCACGCCTGTGACTTCACATCGCCCGTTGCGTCA
GCCTAACGAATCCAGCGCGTGTCCGGCTTTTGGACAATTGGTCTGGAACTCCCACGCGCGGTCCATACACAGGTACAGACATCCCAAACAGCCTCGAGCA
GGCGGACAAACGACAGGTCGAAGCGGGACAACAAAGTACCACGAGGGCGATGTCACCGTGTGCAATAGCAGATCAAACGAGACCCCGCACGGAGATAGTA
GTACCGTTCCACCTCTGTTTGTGTACGGGCAAGTACAGTACCCGAAAACGCAATGCAAGAGACGAATGGAGTCAGCACACACGCAGAACTGAAGAGCTGT
TACCATCTCTCGGTCCAAATGCTGCAATGTCGAGCAAAGACGTGCCGACGATTGGAATGCAATCGCATTCGTCCCGTCGTGCTACGTCCAACAAAGTGAC
AAAGAGACAGGCGACGGACTGGGAAGAACGTGAGCGAGTGACACTGAACATGTGTACGACGTAATTAGAATCGATGGCGGTGCATTTCGATGATTCCTCT
CGATCAAATTTCCATGCAAAAGGACAACAACAACAACGTCAAGAACTAACTTTTACGCCCTTTGACGAGCTTAAGTCCTCTCCGAACTGTGTCGTGTGTC
TCAGCTACAGAGTGGACGGGGCTGGCTATCACGATAGGACATGCGGACGTAAAAGAACCAACCGGTCGCTACCTGCCAGCCCGATCGACGATTGTCTGCG
CTCGAATCTCTTGCCTCGTGCTCCCCGGCCCAGGTTTTCAGGCTGGAGCGAATAGGTGAATAACGAAATGCCGTCGTCACGGACCGTTTCGCCTCGACGT
GTCTCAAAAA