Description :
From Genome Similarity Track
Location :
scaffold_44:153754- 156017
Transcript NameFunction/comments
Plaha_PHALS_05750hypothetical protein

Sequence
2263 bases(100 bases per row)
ggaacttgacaccgtggtctacagggaccctcggcacagtgacacaagtctccGTCACCAAGCGAACAGAGACGGTGTCAGTCAGCCGCGCCTCCAGCGC
CtaagcatacagctggcttccttcgatcgtggatcgtcgattatAATTTTCCAACGCACCAGAATTGATAAGAATTATCCatagcttctcaaagcccttc
actgtcgcttttacgagcaagcccggcttgcacacacgttccttGTTATGGACCGCGcagctctttggggctgggcTTTGTATTCCCTCTacttctttga
ggctcaacagaactcagttcttccccagtagggtgcCTTGCGCCTACTGaattttctcgtttccccacgtcaaaccagattggttagaagcgggacgtcg
gttcgacgaatctttacgcgccttgcgcaggggacaacccgtccgaaggtgacgggtgtttacacgctgctcagcagctcgtaGCTTATCCTCCTCCTTC
TGAGcttgctgagatccattggctcaggcccgcccGACGAagtctgagggtgtgcattccaaccaagtcgtgcctacttgaagttgaattcggcatttga
taccacattcactgctttctaaaagaagatggatgcacacggaagacttccattctggccacgccagtgcgaaggccctccataaagacggtcactgcaa
aCACCTcgaggagaggatctgctgatatcccggcaatgagagctcccaattcttggacaaagtccaccaactccttcttgctctatcgggcagcaaggaa
acgcgatccgACCCGATATGTCTGATaaagcggcgagaacactcgcagaagctgacacatcagctccttccaggaggaaaACACCGCTTCCACCGGAatg
ccgcacgttagtgcccattctcacgctcgacccccgagcttggggATAGCTAGCGTCAAGCGctattgctcgttttggagcatggctgatgccatagcca
tacCAGCAATATggtatccagagcaggagattctcttcatccctACCCACagaggtcttaacgctcaccatgagcggcctgggtcggaaggaatcatTCT
GATGACAGATTCTACTGTAAGTGCtccaacagagcattttcataacttgaaaacaCCTCAAagcgcgcgcttatggcctcgAACCCTTGCGCATCAATCT
GCTCagcgccctcagggcccagcaggggcatcagcttattgagcccgttctgcatgccctCGGGCAAATAAGAGTAtcactccatcctcacagaggattg
GTCGTAATGACTggggcgtagattgactacgagtggtaccaagtgcagcggggctaccgtagctctttgcttggaggaagcatacctaaggccaccgacc
ttacgttctttccaagaaccagttatagtgtagcggatcgcaatccgataTTTCTAACTatcaaaaaccttaaccaagatgAATGACAATCATTGTtctg
tttaaattcaaaactgtatttaattgttttagttgcggcggcatccaatatctaaaaccctaggatTTCCCAATACTAATTCaataatacctaattaata
tggtaatatgcattactactggcatcCTGCCACGTAATGGCTtcatgttacggtgtagccacaccactgtgttagtACACTtgcttgtgtaatacacacc
tatgaaCGGTCGCACacgattgtgcgacccgctttttcatacaagggtatgtgtaaccccgttacactgttccagccacgaacTGCCTTGTtgcttaagt
gtagccacatcattttgtggtcgtaccatcttgtgtaacccacatcattgtgtgatcatacgatcttgtgtgacccacacccttcataccagggcacgtg
aaaccccatTGCACAAGTCTAgccaatgcagtgcatttgcgGTATGAATGTCGACTCTACtagcaagaagaagaagacctGACTATAGTAGGCGTCTGAG
TCGATGGAATCATCGTCCAAGCTACGAGAGAAGCGGTAGTTAAGCGAGATAACTTACACATTCGATCACCTGGGATTGGCATCGAATTGTTTAAGTAGGA
AACGAAGATCAATCATTGCCCCTCGGTCTCTATTCTGGATTCGATGGTTGCTTCGATAGAGCTTTACTAAGCTTTTAATAACGCAGCACATGTATTCATT
TGATCCGTACGCTAGACGTATCACCTCTTCgattcacgacggtgacgtcgtgaATTATAGCAA