Description :
From Genome Similarity Track
Location :
Scaffold_32:153711- 156324
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G010768Protein of unknown function
Pytul_DAOMBR144PYU1_G010767Similar to Lrrc40: Leucine-rich repeat-containing protein 40 (Mus musculus)

Sequence
2613 bases(100 bases per row)
TACGGTGGCATCCAAAGATTGGGAACACGTCCGAGCAGAAGCCCGTGATGAAGCTACACGCCCAGGGCAGCGTTAGCAAGATCTGCGCGGCGTCGAGCTG
CGCTTGCTGCAGCTTCAGCTCGGCTTTCATCACCGGCAGCAGGCCACGCTTCAGCATCGACGTCAGCAGACTCGCAAACATGAGCGACATGAGCAATCCG
ATGTGCTCGGCGCTAAAGAGCGTGGCTTTGTGCGTCTTTCCCCTGCGTCGCGACCTGTGACGCTCACATCGCGCATCGTCATCGTTGGCGACGTGGAGAA
CGGATACCTTGGCAGGGCTCAGTTCGATATGGATGCCCTCGCCAAACACGTCGCCCGCCGTCTTCGCTGCCGTCGTGCTTTTCACGTGGTAATGCGCCGT
CGCGCTGCTCGCAGGCGTGATGCCGAGTTGCGACTGAGCTCCATGCTCCGACTGGTATGGTGAATCTCGGGGACCGGCAAGGGCGGCTCTGTCTTCAGCC
AGGGAAGCCTCGGTCGCCATGCTGCTTCCGTTGTCGCTCTCCTGTCCGCTTGTTCGTTGACTCCGCCTGACCTGCTGATTGGCGAATGAGCGGCTCAAGA
AAGGCGATACGTCCCACCCGCCTTCCTCCCTTCTGCTGCTGCTGCCCGTGTTGCTACGTGGTAGGATAGACGGGGGCGTGGGTGCGCGTGATGCGCTTGC
TGCGGATGTGTGTCAGCATCTTTAGAGTGGTTTATCGCCGTCAAGCGTTGAAATCGTGCACTTGGGATTTGCGCCATGCGGTCCGACAGCATGTTGCTTG
CCTGCAGCGATCAAGGTGTGTCACGAAAACAATCTACCAGTAGATACCGGTACCTGATCCGAACTGATACTGGTAGTACTATTGCGTCTATCCGCTTAAA
AGAGCCGTGACTTAATCCGGATGGTGACTTTAACAGTCACACGCTCACCACGTCAAAAGTGTTCATCACTTTCACCAAGTAAACACGACCGACCGACCCG
TCGTCCGTAATCGAGTGACTTGACTTGACACATCCGGATGCCGATCTCAGTCGGTTCGCTTATTCTAGCTAATGGTGAGCGGTGGATGTCGCAAAAATAA
ATGAGCAGCATGCGCACGTGCCGTGATCATGTATTCCTCATTTTAGCGCCGTGAAGAATTCATTCGCACATGCACTAAGGTACGCAAGGTTTGCTATATA
AAGGAGGCGCTTTATGTATCAACACCGCGTAATCGTCAAAGGCAAGCAAGCCGTTTGTGTGCATGCAAGTGACGCAAGAGAGGCGGGCACGCGCAGGATC
GAGGCGACTCGCGCATTTCCACTCTATGGTTGTTCCCTTGACGCGGTCATTACCGACCGTAGATGCCGTGTCCGCACAACGCAAAGCGGAGTTCTGCGCA
TGCCGTTGTCACGCGCACAATGCAACGCCGGTTCTTCCCACGTTGCGGTCCTGCTCATTATTGTCGTCGCCTAATCCAGTCAGATAGAGAGAGGCGCACC
CATGGCGCCCTTATCCGCCTCTTGTCGTGCGTATGGAATCCATAGAAGGATGTATTTTCTGTAAAGAGGTTTTGTTAGTCGTCAAGATGATGCTTTAATT
AGTTACACAGGTTTATGCGCGATATCCAGACCACTCTAAAACGCTTTGCGTACAGTTGTCCTTGTTTTTCCTAAACCCACAATCGACACTCACAAACCTC
TTTCGACACATCACTCTATAATTCTGTATGTTACCTAACACTAGGTTCATTCATCGTACTTTAAAAGCATTTTTGCCTCCAATAAATAATTTGCATGTCT
AATATTATAAGCAATCACTGAAACGCTGATTGCGACTGTCTCGTCGCTATGTCGCAGAAGAAGCGCATCCTCCTGCCATCCGACTGTGGCACATGGCGAT
GCGCAGCCAATTCTTCCGTGCCAGACGCATCCTGTAGTGTGGGCGTGCAGATAGAGGCTGCTCGCTCCCCACAACCGGCCCTTCCTCCCGCACCCATACG
CCCCTCCCTCTGCCCAAGCAACACCGCTTGCATGCGGGAAGAAACGCCGCCGTCCGCCGCGCATTCTCCCGTTCCTTAACTCCACTGTTTCCATCGGCCC
CGCCAGCGCGCAAGACGATGCGATGGCGGCGGTCGTGGGCTGTTGGTCGACTTGGCAGCGCGATGGCGCTGTTGGTAATGGCTGTGGTGACGTCAGCGCT
TGTCCGATTCAGTGAAGCGGATGTGCCACCGCCGCGTTCGTTGACAGTGGTGTCGTGCAGCGAGATGTGCGCCGACGTGTTCGCTGCGCAGAGCGTGACG
ACCGGCGCGTGCGTCAACCTCAGCGACGGCACCGAGAACGTCGATACATGCAGACAAACGCGTCAACTCGACGGCGTCGCGACGTGCGCCTCGTTTGCGA
ATGACACTGAGAATGTCGCGCTGTGCATCACGCCCGTGGCTAACGCACACGCGTGGAACTTCCGCTTCACGGCGAATCCGGAGCTGCTCGCCGTGGCACA
TGCGCAGAGCCGCGCGCCGCAGGTGATCACGCTGGACGCGGCGAGCGTCACGTCCGTCCGGGACTTTGTCGTGCCCACGAACGCATGGCAGCTCGTGCTG
CAGCCTGCGGATC