Description :
From Genome Similarity Track
Location :
Scaffold_1875:1537- 3173
Transcript NameFunction/comments
Phypl_g14309hypothetical protein

Sequence
1636 bases(100 bases per row)
CCCACTTCAGACATCTCCCGTCCACAGTCTTCGACTTGAACAGCCATCCCAGGACCGAGTATCGCGTGTACACNCGTCCACGGTCTTCGACTTGAATAGC
CATCCCAGGACCGAGTATCGCGTGTACACCCGGATCGTCTTCTCGGAGCATCCCGTGATCATTGTGTGATAAGTGTTGAGTACGCGGAGCAGGGCGAGGA
CCTCCTTTTCCGCCGGGTGATATCTCAATTCAGCGTCTTGGAGAACACGTCCCACGAATCGTACGGGTAGCACGACACCATCATAGTCTTGTCCCAAGAC
GGCGTTGATGGCCCACTTGTTCGCATGCAAGATGATGACATACTGCCTCTCGGGGTCCGGGTGCTGCAACAGCGGGGTCGACACCAGACgttccttcagc
agcttgaacgaNCCGGGTGCTGTAACAACGGGGTCGACACCAGACgttccttcagcagcttgaacgcgTGTTTGGCCCTGTCGAGGTCGCGCCCcgagcg
gagctgctcatcgGATAACTCGTACAGTACTGCCGCTATCACTGGTAGGtcctcgatgaacttgccgTAGTAATTGAGACTTCCCAGGAAGGATTGTACC
CCCTTTAGTGTCTTCAGGAACGGCAGGTCCAGGACTTTCGTGGCGAACTTGGGAGACGTGCGGATTCCATCCGAGCTGATATCATGACCGAGGTACTTGC
AGTTCTTCACACCAAACTCGCTCTTCGGGAGGCTGACAGAGATGTTCCAGTATCGCAGACGGTATAACAGAGCATTCAGGATCTTGCACAAGTCGTCCCA
GGCGGGGCTCCGTAGATAATGTCATCGATGTATGAACTCCGGAACAGGACAGGTCTCATCTGCTCCGAGGAAACCCGGTTCTGATGGAAGACCGTATCCG
TGCCGGTTCGAGAGATACCCGCCCCCCCGGGGCTCCGTCCCCTGGGATGCTTGGGCGTCGACATCTCGGTCTAGTCCCAGGAACTTCAACACGTCGGgat
ccaccagcttctcttCGTCCGGTGAGAGCCGGACGAAACCCCAGAGACAATTGTCTAGGAGCTGCTGATAAATCAGCGGCGCATTCTTCAGACCGAACGG
CATACGCTTCCACTGAAANGACAGATGAAGGCCGATATCATCTTGGCTCGGGCAGTCATAGGGACCACCCAGAAACCACTTGCCATGTCCAAAGTCATAA
ACCACATCGTTGCTGAGAAATTGctcacgagctcgtcgatcagcggcagcgggtAGTTCATCAGCTTGATCAGCTGATTCACCAGTCGATAGTCGATGCA
CAAGCGGATATccttgccgttcttcttcatcacgatGACGATCGGCGATGCCCAGGCTGACTCCGAGTACTCGATCAAACCCGTTTCCAGGagtcgcttg
agcagctcgtagaCCTTGGGTAACAAATCCCCAGGGATCCGCCGGGTGCGTTGGGAGACCGGCTTTGAGCCGCCGACATCGAGGTCACAAACCACTCCTC
CGGCAGGCGACGGCAAGGCGTTACCTTCACCGAGGAAGACCTTCTTGTGACACCGCAGGATGATGCGGAGAcgctcttcgtcctcgggGCCTGTCTTATC
TGGGTCACCAACAACTGcttcgtcgatcttggcctc