Description :
From Genome Similarity Track
Location :
Scaffold_29:15368- 19084
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_29-fgenesh-gene-0.16Amino Acid-Polyamine-Organocation (APC) Family
Pytiw_DAOMBR242034maker-piw_contig_29-snap-gene-0.3926S proteasome regulatory complex, ATPase RPT4
Pytiw_DAOMBR242034maker-piw_contig_29-fgenesh-gene-0.6DEAD/DEAH box RNA helicase

Sequence
3716 bases(100 bases per row)
TTGTCGAGCATCTTGCCAAGCGTCTTGATCGCCGCGCTCGAGTGCGGGTGCACGAGCGGCCTGGCCTGGCGGTAGAGCTCGACCGCGGACTCATCGTCTT
CGGTAGCATCGTCTTCACTCGCATTGGCGTCGTCGTCATCCGAGTGGGGAGGCGAGGGGAACGGCAGCAGATACCGGATCGACGACGCCATGGCGTCTAT
ATGAGCTCTTCGCATTCATGCATCATGGCTGGCATCCAAGAGCTCCGATGGCATCTTTTTAGGTCGCGTGTATCTATTCCTAGACAAGTTGAAGACATCT
TTAGCTCGACATGGCTTAACACGAAGGAAAAATAACACTTCCGCGGCGGCGCACATGCCAGTCGACAGTGCACCAGACGCACGAAGCGAAGCCCAGGACG
AGATGCGCAAGACGAACCTGAACAGCGAGACAGAGAAACCCCCCAGTACACAACCCACACATACAAGAAGACCGCGCAGGTACGCACCAAACTCTCCAGT
GGCTTCAGTCTTCCGTTCTTTATCTCTTAGACTTGCGCTCTTCGTACCTCCCAAGAAGCGCGCCACTCACCCACTCACGCAGGCTTCTTCTTGACTTAGA
CCTTGGAGTAGTCCATCTTGGACTCGAGCTTCTTGTTCTCGCCCAGCTTGCGCGCCGCCTTCATAAAGTCCTCCTCGAGCACGTAGTCGCGCTCGGCGCG
GATCGCAAACATGCCGGCCTCCGTGCACACGTTGCGGATGTCGGCGCCGTTGAAGCCGTCCGTAAGCTTCACGACCGACTCGTAGTCGATCTCGCCCTTC
TTCGTGATCGGGTTGGAGTGGATCTTGAGGATGTCCATGCGCGAGGCCTCGTTCGGCAGCGGGATCTCGATCTTGCGATCCAGGCGGCCGNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGTCCGGTCGGTTC
GTCGCCATCACCATCTTGACCTGTCCGAGCGCATCAAAGCCGTCCAGCTGGTTCAGGAGCTCCATGAGCGTGCGCTGGATCTCGCGGTCTGCCGACGTGC
CCTCGGAGAAGCGGCTGCCACCGATGGCGTCGATCTCGTCCATGAAGATCACGCACGGCTGATGGTCGCGCGCGTAGCCAAACATCTCGCGGATCACGCG
CGCGCTCTCGCCAATGTACTTGTCCACGATCGCGCTTGCCACCACCTTGAGGAACGTCGCGTTGATGTTGCATGCGAGCGCGCGCGCCAGCAGCGTCTTA
CCTGTGCCTGGTGGGCCGTAGAGAAGCACGCCCTTGGGCGGCTTGATGCCCACGCGCAGGAAGAGCTCCGGGTTCGTGAGCGGCAGCTCGATCACTTCGC
GCAGCTCGCGGATCTGGTCGTTGAGCCCGCCAATGCTCGAGAACGACACGTTGCCGCCGTCCTCGTGAAGCATGTGATACACCGTTGGGTCCACCTCGCG
CGGCAGGTAGCGCATGATCGTGAGCGTCGTCATGTCGAGCGCCACGCGCGTGCCACTCTTGAGCTTGGTCTTGTCCACCTTGGAGCGGCAGCCGACCACG
TAGCGCGGCCCGCTCGACGCCTTGACGATGAAGCGGTCGTCGTCCAGCTGACGTAGCACTTCGCCAATGATCTGGCCCACGCTCTGCATCACGATAGACG
AGCAATAGGCACATCCATACTCAGTTTTGAACCCCATAACCGTTATATTCATGCGGCTTGGCTAACGCACCTGCAAGGCCTTGAGGTCGTCCTCGGTCTT
GTTGTATTCACGCACGAGCGCCTTGACGTTCTCACGCATGTTCTTAACTCTGTACACGCATACACACACAAACGACGCATCCATTGAGCTCTCGGATACC
AAGTCACAAGATGAAAAGATCCAAAAAATATCTTCTCGTTTCGCAACAGGCAGAGCGCCACACAGCAACTGAGAGACAGCGCTCTCCACGGATGTGTAAC
AAGAACGCACCTGGACTCCATCTCTCGGTGCTCGCGCACCTTGGCCTTGTAGGCGCTCAGCACCTGCGCGCGCTCTTCCTCCGTCGTCGACGCCGACATG
CTTGCTCGTCCTCGGCTTCTTTCGCTCTTTGGGGGGATTGCGATGAGGAAACACAGAGGATCTCGCGCTACATAAAGAGGTAAATTAATACATTTTGGAA
CATAAACCTTTATAAATGATTCATTATATAATAAGTACACTCAATTAACCTGTTTATTTAGCAGTAGGTATCATGCAAGCGTTATACAAGGTCTTATCAA
TTGTATACCGGTTTCATCAGTCAATACCGGTATTTCTCACTGGCGTCCAGTCAATTCCAACCGAGTGAGCTCGAAACGGTATTGTGGAGCTGCTCAAGCT
CAAACGCATCGGACGAAGAGCACGCGCAGTGAGCGTCTCCTGGGCCACCTCGTCCCCTCCGACAGCCGCAGCAGTCGACCAGCAAGCAGCATGACCGACC
CGCAGCTAGGCAAAGTGAGCGAGAACCTCCTCGACGCGCAGCAGTCGTTCACGTCATGCGACTTTGGGCTCGATCGGCGCCTCACCAAGGCCGTCGCCAA
GATGCGCTTCGTGTACGCGACGCTCGTGCAAGTGCACTGCATCCCGCTCGCCATGCAGGGCAAGGATCTGCTCGTGCGCGCGCGCACGGGCTCCGGTAAG
ACGGCCGCGTTCGCGCTGCCGCTGCTGCACAAGATCCTGCAGCAAAAGCAGGACCAGTCGAGCGCCGGCGCTCTCCAGCCGTCGGTCAAGGCACTCGTGC
TCGTGCCGACCAAGGAGCTCGTGGAGCAGATCAAGAAGCACATGGGCGAGCTCATGTACTACTGCAACGACGTCGTGAGTCTCCTGGCGCTCGGCGGACA
GAGCATGAACGCGCAGCAGGCGCTGCTCCGCGACGTGCCCGACATCGTCATTGCGACCCCTGGCCGACTGGTCGCACACCTGGAAGCCGGCAACCTGAAG
CTCAAGGACTCGGTGCAGACGCTCGTGATCGATGAAGCCGACCTCGTGCTCTCGTTTGGCTACGGCGAGGACATCCGCACGATCTTCAACCACCTGCCCA
AGGCTTGCCAGAACTTCTGCATGTCTGCGACGCTGAGCCCCGAGCTTGAGAAGCTCAAGAAGTCCGTGCTGCACAACCCTGCGGTCGTGAAGCTCGAGGA
GGGCGAGACCGACGGCAAGCTGCAGCAGTACTACTTGCCAGTCGCCCAGGCGGACAAGGATTTGCTGCTCTACGCGCTCATCAAGCTCGGCGTGATTCAG
GGCAAGGTAATCTTCTTCGTCAACTCGACCGAGGCCGCGTACCGGCTCAAGCTCTTCTTCGAGCAATTCATCATCAAGAGCGCCGTGCTCAACGCCGAGC
TGCCGCACAACTCCCGCCAGCACATTATTGAGGAGTACAACCGCGGGCTCTTCGACTACCTCATCGCCACGGACGACAGCGTCGACCGCGACGTGGGTGA
GGCCTCCGACGAAGAAGAAGAGGAGGAGGAGGACGATGAGGAGGAGAACACGGACGACGAAGAGGCCGAAGGTGACGACGACGCCGAAGAAGCCGAGGTC
GACGTTGAGGAAGCTA