Description :
From Genome Similarity Track
Location :
Scaffold_3:153678- 155925
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_3-snap-gene-1.44Mitochondrial Rho GTPase
Pytap_DAOMBR444maker-pag1_scaffold_3-snap-gene-1.33Evi5 protein

Sequence
2247 bases(100 bases per row)
AAAaTCTCCTCCACTTCTTCCTCAGTGAGATTACCGTCCTTGTCGCCGTCAAACTGACGCAACAAGCCATCCACAAAGTCGATTGCTGCCTGTGTCAATT
CACCTGACTGGTCTTCTTCATGCATtGGGAGAGTGATTCGTTCTGGTGGAATTTCAAGGTCTAGCGAGCCATCGTAGCCTAGGCTTCGAAGCACTTGCCA
GCATGACTCAGGGCGCTTGCGGTCGATGAAGAGCTGCCACAAGTACACAAAGCCTTCAAaCCGCACGCCACTGCCGTCCTCTTTCACGCCTTCAGGGATT
GTGGACTGGAGGAACTCCATCATCGTGTCCATCTCATTGCCCAGGAGACGCATGCCAAAACAGTCCTGTTGATACTCATTGAGTTCCTCTCGACTCAGCA
AGCCGTCTCGGTCGCGATCAAAAAGACGGAATGTCCGCTTGATCGCCTTGAGGCAcTtGGGCTCCAGCATACGCTTCTTCGCGTTGTATAATGGCTCCAt
GGGATACAGCACCGCCTTCTGTGCGTAGTAAAATGCCCGCGCCACCTgtGCAAAGTTACGTGCTGAGCAGTCTCCACCATCAACCGCAAACTGGTACGTG
TTGGTGAGCTGACGGATCTGGCTCGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNTCGAGCCACCGGCGCAGCCGCTGGATGGTCTCTGGTCGCGTGAGGTCATACACGAGCAGAATTGCGTCGCTTCG
CTTCGTCGCGTTGGCCACGCGCACAATATCGGACACACGAGCTGTGCACAACACGATATCAGTCCCCAGAGATCACGCACGAGTAGCTACGtAACGCAAA
ACGCACACGATGTGTCCGTGATGGAGATGATCACGTTTtCGTTGTTCTCCTCCgCCGGGATCTGGACGTTCAGCAGCACCGCTGGCACACGCTCACTGAA
GTGGCGCGACACGAGCGAGCAGATGAGCGACGTCTTGCCCACTTTGTCGTCGCCCAGCACTTCGATGCGCACGACCTGCTGCTTCATCGGTCCCACGAGC
TTCTCGCGCGGTTGGCTcGCGCTGGCGCTTGCCGCTGCCACCGCCACTGCTGCTGCTACCGTGCCATTCGCGCCTGCATCTCGCTGTGGCTCCAGAGCGC
TAGGCGCCGCCGCTCCCGTCGTGCCGTCCACCATCTTCCTCCGATTCGTGGGCGTCCCGTCCTTCTTCCCGTTCCAAGATGTGCCGCATCGCTGACGCcA
GAGCCACTATGTGTCTCAGAACAAGATGTGGCACaCTTCTTGGGTCTACTGAGTTGGGATTGGTGGAAAACTCGGAATCATCTTCCATGAAGCGGCGCTT
CTCGTGAGAAGCTCATCAACGCAACGTGACCGCGTTGACGcGGATCGGCGCATCGCGATTGTACCGCATTGGCTCCTCTGTAGCGCCGACGACTCGTTGC
ATTTACACCGCAAACGCGTGCATCTCCGGTCGGGTGTGTGTGTGGGTTCGCCACgCCGGGGGCACGCATCGCCAGACGAGGAGgCGCCACCACACGTTCC
TAAATTATCGAGTGACAAAGATCCTCGTCAGTCAGTCCACCGTAaTCTCCGTCGCAAGCCACTGGCTTATTCTCGCAACGCGTAAGGAGTGTGCTGgAAa
CTTTGGGCCGCGTGCTGGGTGAGGAGGGCTCAGTGCCAATCTGGCGCAGTCGACGGCGAAGAAGGATGACCCTGGAGGATGCCACAGGCGACGGCAGTAC
GACGCACCGTCcATCAGCTGTGCgCCCAATGGAGCTTCTTGCGATCAGCAACAACACTAAAGAAAGCAGTGAGAAGAAgAAGAGTGTGGAAGAAGAAGAT
GAGgAAGACCGGGATGACAAGAGCTGGCGCACGCGCGGCGAGTCGTCTCCGTCGGCACTGTCATCGCCACTGCAGTCTCTGGCAGAGCTTTACCGtGCTC
GAGTACCGCACTGCAAGCGTGAGAGCTTCTGGCGCAACGTTGTGCGCCAGTTTAATTtCACGGATCCGGAGGAGCGCGCTCTTGTGCTGTCGCTCACGCA
GGGCATTGATTGGATGCATATGAGTGTGCTTCCACCGACGTTTATGG