Description :
From Genome Similarity Track
Location :
Scaffold_511:15367- 19690
Sequence
4323 bases(100 bases per row)
CCATGGATCTGCTAACAGGGGAGTCCCGTGGATACTGGAAGTACCATGCCCCAGGAAAGTGGTTCAGACAAGCCAAGGTAGGGGGCAAGATCAACAATGA
AAAAGCAATCCTACTTCTAGATAGTGGTGCCGAGGTGTCTATACTGGATACCGCCTTTGCTCGTAAGGTTGGGTGCCAAGTGGATGGGAGTCGGATCCAA
GATTGTGTTGGGATTGGTGAAGGCGTATACCGTACAAACGGGAGAACGCGAATTAAGATCACGCTGGCAGGTTGTTTGGTGTATTGGTTTGACATTTGGG
TCGGGGATCTCGCTGGTCAAGACGCCATCCTTGGGATGGATTTCATGGTGCCAGCTGGAGTGAGGTTGGATCTGGCGGATGGGACACTTTGTTTCCCTGA
CGAGATGCGGATCCAGCTCAGCGGACGGCGGCCGTTGTATGGAGCGAAGATGAGGATCATAAGGGCGGATAAGACCACCTGGATCGAGCCCGGGGAAACT
TGGGAGCTGTCAGACCGGTTGAAGTGGGTGGAACATGAGAAACTGTGGGTCACTCGGGGCGAGAAATGGGTACCTACCGTAATCCAAGGACCAGGTCGAT
CGCAGTACCTCCGGGTCACGAACGTCAGCGACAAGAGACTATTACTGGACCATTATGAGGAGATCGGACGATGGTTGGCGAAGGACGGTATCCCTAGGCG
ACCTGGATATGTGTCAGTGGGATCCCGCCGCTACAAAGAATGGCAGAATCTGGTGTACGAGGCGACTACCGAGATCGAATCTCTCGGAGAGGTGGAGCTC
CTGGCGGAGCCAACTGGCCCCTTGGTGGATCGGCCTTCATATCCAACTCCGCGAAAGATCCTGCAGAGAGATCGACGGGTTGAGATCCAAGCAATGGAGG
TTGGATCCATGACGGGGGACGATCCCCAGAGTCGGCCCTTAGATAACGCAGGGTCGGTGGACGAAGGATTGCAGAGGGCTAAAGCCGAACAGCCGGATCC
CGCCGATCCACAAGTGGATCCAAGCTCTCCATTGGATAAAGTGCCTGGATCCCTATCGAGAGTGGCAACGCTAGTCAAACCCGAACTGTCGGGTTTAGAC
TCGTTAGAGGACCGGCTGGATCCAACCGGTGACTTCCCCAGTACCAGGATACCCGACCCCACGAAGACAGAAGGGATGACGGTCGAAGGAGAGTCGCGGT
GCCTGGATCCAAGGGTGGATCAGACAAAGACCGAAGATGAACAAGTCTGCTACCGTGAAGGCGGGGATCTACACGCCGAGGATCTTGGAGAAGGTATGGC
GGTAATCCCGGAGGTACCACTGACCACCGAGGAGGTCACGATTGATGATATCCAAGTGGATCCAGGGGCGAACGAACCCACTGAAGTGGATCGTCTGCGT
CAGAAGATCTGGGAAAGCCGACATCTGCTGATCGGTAAGGTTAATGCGTTACCGTCCCGCCGCCCGCGGAGTCAAATGTGACATCGATGTCGGCGACGCG
AAAACCGATCGCTCAAAGGGTGCGGAAGGTGCCACCTCAGTTTCTGAGAAAAACTGTCGTATCTGATTAAGGCCTGCTGCAAGCAGATCATCAGCTCTCA
CGTCCCCGTGGCGTCGCGTGGTAATCATCATCAAGAGAACGGGGTGGATATACGTCTGTGCATTGATTACCGGCTGGTTAACAGCCTGACTCGATTAATG
GTGTATCCTATGCCTCTGATCAATGAGCTGTTGGAAGATTTGGATAAAGTACTCTGGTACTGTTCTCTAGACATGGCCAGTGGTTTCTGGGTGGTTACTA
TGACGGATCGAGCTCGCGCAATATTCGCATTCATCACACCGTTTGGCCTGTTCGAGTGGACCCGGATGCCGTTTGGATTGAAGAACGCACCCCAGATCTA
CCAACGCCTCATCGATAACGCCCTCTATGGGTTCACCCGAATACCGGAGCCCGAAACGGGTGGATCCGGGGAAGGTGACGCAGAAGTGGATCCATTCGAA
GCGGGGGAGCCAGGGGATCCTGGGACCCCGTCTGTGTTAGGACGCAGATCTTACATCGACGACATTCTGATCCCGGCGGAATCGTGGGATCAGTTGTGCG
AAAGAGTGACATCCCTACTGGAGGCGTGTACTAAGTAGAATCTCTCTATCAGTGTGGTTAAGAGCTATTGGGGGATGCGCAAGGTGGATTACTTGGGCCA
TCGAGTTTCCAAGGAGGGATTGGAGGCGAATCCTAAGGACCTGTCATCATTAGTCGATTTGTCCTTCCCACAGTCGTTACGAGCGATGCAATCCTTCTTG
GGCAGTTTGAACTACTACAGTCGGTTCATCGAGGATTACGCCCTGTTTGCCGCGGTGTTGTATGAATTAAGAGAGGTAGATTTTGCTGCGATGACCGCTC
CAGCTGTCCGGATGAAAATCCAACAAGCTCTGGCCCGGGAGATGTCGGATCAACGAAGGAATCCAAGTGGTATGACGTCAGAAGAGGACCTAACACAGGA
GCTGGATCCACCCCGAGACCAACAGAGAGAGGATCCAGTCTGGATAGAGACGACGGATCAGAACATGGAAAAGGCAGAATCTCGGTGGATCCGAGCTCAA
CACGCATTCGTGGAACTGAGTAACAGGATCGCGACCACGCCTATCCTCCGTCATTTCGATCCGGAACGTCAACCTACGGTAATAGTTTATGCCAGTGACT
GGGCAGTCTCAGCAGCTCTGGTGCAAGAACATGAGGGGATCTGTCATCCAGTCACCTTTGTCAGCCGGACACTGAAGCCGAATGAACTGAACTACGGAGC
GGTGGAGAAAGAGATACTTGCGCTCCTGCGCGTGTTGGATCTAAATTATAACCTGCTAGTGGGAAGATCCATCCGGATCCTAACTCGACACTCCACGCTA
GCCTGGCTGTTCAAGTCGGCCGGGTTGCAAGGACGTTTAGGACAGTGGGCAGCTTTACTCTCACCTTGGACGCTGGAGATTGTGAAATGTTCGAAAGGGG
AAGACGAGATCCTGGGAGTCTTGGCCGCGAGCATCACTCCTCGAGCTAAGATGGATGAGGCGCTGACTAAGATCGCCCCTAAGAAAGAGCCCAAACGCCG
GATCCAGATCCCGATCCCGACGGTACAGGTGGATGAGGATCTATACGTCCTGAGTTTCGATGGATCCGCTCGTGTACGACGCGGAGGAGGAGCATACAGT
GCAATACTGTGGAGATTGCCCGGATGGGAAGTTGTACGGGCCAGATCCACTTACGCGGAAGGCCTCACCGTCAATGAAGCGGAGTATAACGGACTCCTTC
TGGGTTTGAATTTACTAAAGGGACAAGATCCGAAACGGCTGGTGATTTGTGGGGATTCAAATTTGGTAATCAGACAGGTGCGAGGTGAGATTGACTGCAA
GGCCCCGGCCCTAACACTGTTACGGCAGAAAGTGATGATCCACCTGCGTGGTTGGTTGAATCACGAGTTGGTACATGTCAAGCGAGATTGGAATGCCAGT
GCGGATAGTTTGGCCAGTGCCGCTTTACGGAATCAATGTGGTGTCGAAGTGGAGGGAGAAGCCGAACATCAGGATCTCGTTACGTTGAACCGACTTGACG
AAGTGGTAGTGGTTGGATCCGGAAAAAAGACAGTCCAGGTGATGGCTGTCACTAGATCCAGAGAAAGGATTGGATCCAGCCCCCCGATCCTCGAGGAAAC
ATTCGTGAAGAGAGTTCGCATCGAGCGGATCCTCAAAGCACAGAATGAGGAAGCGTGGATCCTGGGACTAAAGAAGTATCTGATGGGGGATGTACGAGAC
TTAAGTCGGGAGGATGCCAAATCCTACAGCGTTATCGCTACGGATTACGCGGTGGATCTGAACGACTTGCTCTTCTATTGCCCCCCTACGAAGAGAGTCC
ACGAGGATCGGGATGGATTGATGAGATTGGTGATGCCAGAAACCTTGCAACAGGATGTCCTACACCACTACCACGCTAGCTTGGAAGGCGGACATCAGGG
CATTGGTCGGACCTACCAACGGATCCGGGAATGTTTCCATTGGAGAGGACTATTCAAGAGTGTACAACGATATGTCGGTGAATGCGTGGATTGTGAGACA
GGCAAAGGCAGACCTACGATCGAAGGGGAGTCGCCTGGGAATGTCCGAGCGACTTACCCTTTCCAAATCATAGCCATGGATCATATTCTCTCGTTGCCCA
AGTCGTTCAAAGGAAACACAGAATTGTTGATTTGGGTGGACCTGTTTACCGGATATGTGATTGCCAAAGCTAGTGCGTCTAGAACTGCGCAAACCATTGC
GGAATCATACGAGGAGTGTGTTT