Description :
From Genome Similarity Track
Location :
Scaffold_34:15367- 16454
Transcript NameFunction/comments
Phyta_totarag1689hypothetical protein PHYSODRAFT_554371

Sequence
1087 bases(100 bases per row)
CTCTTCTTCAATGTATTGCTGCCGCCAATCATCTACGAAGGCGGCTTCTCCATCAAGCGGCAGGCTTTCTTCCGCAACTTCCCGGCTATCATGAGCACGG
CGGTCGTTGgcaccgtcgtcgctgcgaCTATCACGGGTGGTATACTGTACCTCGCTGGGGCATCGAAGATGGTGACGAGACTTTCGTGGGTGGAGGCTCT
GCTGTTCGGCACGTTGATTAATGCAGTGGATCCGGTTGCTACTCTGTCGTGCTTTAATAAGCTGCACGTCccgccgctgctgttcaacCTCGTGTTTGGA
GAAAGCGTGATCAACAATGCAGTGGCTATTGCGTTGTACCAGACGCTGCACAAATGGGACGTTGGCACCGACTTGAGTGTGAAGCAGTTGCTCCGAGTGG
CTATCAACACGAGTGGAATGTTTGTGGGGTCACTTCTTGTGAGTGCGGTGATTACTCTGAGCGGCGCCTtcctgctcaagcgcaaggtCTTCTCGTCGCT
ACACTCCTTCCCCAGTTATGAAATCTGTCTGTGCTTGATTTTTAGCCTGCTGACGTATTATGTGGCTGACAGCCTGAAGTTGAGCGGCATCGTTGCACTA
TTCTTCTCGGGAACCACGACGGCTCACTACCATTTCAACGCGCTGTCACGTGAGGCTCGGCATGCGTTTACCCATTTGCTGCACACGTTGTCTTTCGTGT
GTGAGAACGTCGTGTATGTGTTCATGGGCACGTCGGTAATCATGATCTTTTCGGGACACCCAGAGCGGAATTCCGGCGCTGCGCTACGCGTGGACGACAT
TGATTGGCACTTCATCGGTCTTACAATTGTGGCCTGTGTCGTGGCGCGCTTTTTCAACATTTTCCCACTCCTGTGGCTTTCCAATTGCTCGAGGGAGTCT
TCCGACCGTATTCCCGTCAAATACATGGGCGTGATGTGGTTTGTTGCACTTCGTGGATCCATCGCGTTCGCGCTCGCCAAGAACTGGAACTACATCGGTC
GGTACGGTTCCCACCGTCAACTCGTGGAATCCACCACTctggtcgtggtgctctTTACGACGATTGTGATCGGCGGACTTACGGGGC