Description :
From Genome Similarity Track
Location :
Scaffold_42:153653- 155679
Transcript NameFunction/comments
Phyin_T30-4PITG_15519Putative uncharacterized protein

Sequence
2026 bases(100 bases per row)
TTTGTCCGACAGAACGTAGAGCAAGTCGTCGCCCGTAATGACTTCAAACGGCTGAGGGTTCACATAGACGTATCCAAATGGCACACTGCGGTCCTTTTCC
GGGACTTCGATGCGAGCCTTAGACTCCGTTTCATTGGCAGCATTCATGTACGGGTGGCATCGATACAACCCAATCATCAAAATGTCATCCGACGACAGCA
GATAGTGGAAAACGTACTCGAACGAGCGTCCCACGAAATCGAGCGGCACCTCGACAGCAAAAAGCGAGCTGCACTCAAGTTCTGGCTTGGATTTATCACC
ACGCAAAGTAGCCCACGCCTCGCTCGCACGGGACGTGAACATGAACTCGCCCAGGATTTTCTTGATACGGCCATTGAAAAACTGGTTGATCAGTATACTG
TCACACAGCGACGTGCTGTACGTCAAGCCAGACGTAAAAGCAGGAGAGAGGAAGAAGTTGCGCGAGAACGTCTCCGTTGACGAGAACATCGTAAGTTTAT
CGTCTTCATCAGCACCTGGGAACCAGCCGTTCGCCAATAGATTCTCCGCCACGAAGTGTACACTGGCACGGTTCCCCAATTCAGTGATAACTCGTGGGGC
CTTACTCACACCAATGTAGCTCGTGATAAACCTGTGGAGCGCGATAGATTCCTACAAGGTGATAATAACGCAATCGTCAGTGACAGCGTCAATAGGTAAA
GTGATAGAGCTACGACGAACCGCATCTTGAAGCAGCTCAGCGCTCCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCAGAAGAAATGGCAAGAATGTTGAGTATTCAAGCAAACCAGGGGCACCACT
GGCGCCCCACAAAGATGTCTGGATACAGTGAGCGACAACCGCGAGAAGTCGGAGAAGATGCTGAAGATGCGTGGTGACTGGTGTTTGATATCGCTTCGTT
TGTTCAACAAATCAATGCGTGTGCGTTTATTGCGCTTTGGCGTGTTGATGTATTTTTGTGTGTAGCTTGTGTTTGGTGTGGTGTTAAGTACAAGGATTGT
ATTTAGGTAGAGCGCTTGTGGTGCTGTCCTGGGGATGTAGCTCAAATAGTAGAGCGCTCGCTTAGCATGCGAGAGGTACAGGGATCGATACCCTGCTTCT
CCATTGATCATGTTACTGTGATAAAATCAGTTGGCATCAGCACTTTCCCAAATGTGCACTTCGTAGTTTGTCTGCGACATCGGCTGACCTTGAGTAACAT
TTTCTTTTAATTGCTTTTTGCTTCTTGCCTGCCGTCCTGTCTATCGTCCATCTGATTGTCTCCCGTTGATATCACTGACGGTTCCACGACACGCTTGTAT
TGGCGTTCCGTTGTTTGTCTATCGATTAATCCGTTGACACGCTCCTTGATTCTGCCATAACATCGTGACACTTCCGTCCAGCTACTAGCTGCCTGAATAC
CACAAATAAGTTTTGCTTGTCGCTGACAGTTTATTGCTTCTGGGGTTAGTGCTGAGCTGTATCAGACTGACATCATTGATAGCAGCAAATACCAGCAAAC
ACCAGCGCAAGCGTTCTGCCGAACCAGGCGTCGACGATCAACGACACTATCTTTCAGAAAGTAAATGGCAAGAATGTTGAGCATTCAAGCAAACCAGGGG
CACCACTGGCGCCCCACAAAGATGTCTGGATACAGTGAGCGACAACCGCGAGGAGTCGGAGAAGATGCTGAAGATGCGTGGTGACTGGTGTTTGATATCG
CTTCGTTTGTTCAACGAATCAATGCGTGTGCGTTTATTGCGCTTTGGCGTGTTGATGTGTTTTTGTGTGCAGCTTGTGTATGGTGTGGTGTTGAGTACAA
GGATTGTATTTAGGTAGAGCGCTTGTGGTGCTGTCCTGGGGATGTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTACAGGGATCGATACCC
TGCTTCTCCATTGATCATGTTACTGT