Description :
From Genome Similarity Track
Location :
Scaffold_103:153611- 155045
Transcript NameFunction/comments
Hyaar_Emoy2809542protein kinase

Sequence
1434 bases(100 bases per row)
TACTGCATCATCAAAAACGCTATCATTTTGCGGGCATCTTACCGCGTATTGTTACTAGCAGAGACAAACATTTGCATCGAGTTCGGTAGATTGTACGATA
ATTGATAGGGACAACATCACATGTTGCTATCGTATAGAGCACTGCGCGGATTCTTGAACATCAGCGCTTCACTACGTGCGCAGAATGGACTTGGGCCCTC
CACGTCAACTCTCGATGGTAACAAGTGGTCAAAGTGGTGGTACCATGTAAAGATCGCCGCATCACGCTGATACAATATCGTCGGGTAAAGACTGATCGCT
TTCTGCGACCTCTTCTCAGTCCACGACTACGAATGCTCCATACGATCCAAAGACTTTGACAGCTTCGACACCTACTCCATCCAATATCTAGCACAATGCC
ATGATCGAAGCAAGCCGTCGACGATCGATCGTGTCGACTTTCTAACCTTATACATTTGTGCTTCAAATGAGGCGAGCGCGCGACCGAGCAAAGGTCCTTT
CATCCACTCTACCGTACGTTTTCACGCCTGTGACTTCACATCGCCCGTTGCGTCAGCCTAACGAATCCAGCGCGTGTCCGGCTTTTGGACAATTGGTCTG
GAACTCCCACGCGCGGTCCATACACAGGTACAGACATCCCAAACAGCCTCGAGCAGGCGGACAAACGACAGGTCGAAGCGGGACAACAAAGTACCACGAG
GGCGATGTCACCGTGTGCAATAGCAGATCAAACGAGACCCCGCACGGAGATAGTAGTACCGTTCCACCTCTGTTTGTGTACGGGCAAGTACAGTACCCGA
AAACGCAATGCAAGAGACGAATGGAGTCAGCACACACGCAGAACTGAAGAGCTGTTACCATCTCTCGGTCCAAATGCTGCAATGTCGAGCAAAGACGTGC
CGACGATTGGAATGCAATCGCATTCGTCCCGTCGTGCTACGTCCAACAAAGTGACAAAGAGACAGGCGACGGACTGGGAAGAACGTGAGCGAGTGACACT
GAACATGTGTACGACGTAATTAGAATCGATGGCGGTGCATTTCGATGATTCCTCTCGATCAAATTTCCATGCAAAAGGACAACAACAACAACGTCAAGAA
CTAACTTTTACGCCCTTTGACGAGCTTAAGTCCTCTCCGAACTGTGTCGTGTGTCTCAGCTACAGAGTGGACGGGGCTGGCTATCACGATAGGACATGCG
GACGTAAAAGAACCAACCGGTCGCTACCTGCCAGCCCGATCGACGATTGTCTGCGCTCGAATCTCTTGCCTCGTGCTCCCCGGCCCAGGTTTTCAGGCTG
GAGCGAATAGGTGAATAACGAAATGCCGTCGTCACGGACCGTTTCGCCTCGACGTGTCTCAAAAAGCTGCAGCAAACGCGTTTCTACTGCCGCAGCGGCC
GAGCAGCAGAAAAAGCAGCAGAAGCCGTTACAAT