Description :
From Genome Similarity Track
Location :
Scaffold_421:15360- 18473
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_421-fgenesh-gene-0.3Pro-apoptotic serine protease nma111

Sequence
3113 bases(100 bases per row)
GAGTCCAAGCGCTGGATGGCGAGCCTCGACAGCTGCATCCGCGCCATCGTGAGCATCCGCCTGCTGAGCGTGCGCGCCTTCGACGGCAACGGCGCGTCCT
TCAGCGTCGCCACGGGCTTCGTCGTAGACCAGACGCGTGGCATCATCCTCACGAACCGCCACGTCGTCACACCTGGACCCGTGGTCGCCGATGCCATCTT
CCTCAACAAGGAGGAGGTCGACCTCGTCCCCATATACCGGTGCGAGCGTGCATAGCAAGCTGTCATGTTGTCTGATATTAATTGCTGACTCTGTGGGTAC
ATTTTATAATAGGGACCCGGTGCACGACTTCGGCTTTTTCCGCTTCGACCCGAGCCGCGTCAAGTTCCTCGACCTGCACGAGATCCCACTGGCCCCCGAA
GGCGCCAAAGGTGTGTATCATTTGCACCAAATTTCTTATTGTTGTGTCTCTTCATGCTAGCAACAGCCCTAACACTCGCTATCTAATGACATTTTGCAGT
GGGCGTGGAGATCCGCGTGGTGGGCAACGATGCGGGCGAGAAGCTGTCGATCCTGCCGGGCATCCTGGCCAAGGTGGACCGTGACGCGCCATCCTACGGC
TCCAACACGTACAACGACTTCAACACGTTCTACTACGCGGCAGCGAGCAGCACCTCTGGCGGCTCGAGCGGCTCGCCCGTGCTCAATATTGACGGCTGCG
CGATCGCGCTCAATGCCGGCGGCGCCAAGAAGGCCGCGTCGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNTGCCGCTGGACCGTGTTGTGCGTGCGCTCAAGCTCGTCCAGAGCGAGCTGGACGTTGCTCGCGGCACGATGCAGAC
AATCTTTAAGCACACGGCGTTTGACGAGGTGCGGCGTCTCGGGCTCCCGGCGGAGATCGAGGCCGTGGTGCGTGAGCATTTCCCAGCCGAGACGGGCATG
CTCGTGGTGGACCAGGTGATTCAGGACGGCCCGGCCGACAAAAAGCTGCAGACAGGCGACATCCTCATCAAGTTTGCGGGCAAATACGAGACCAAGTTTC
TCAATATCGAGGACTTTCTGGACTCGCACGTGGGGCAAAGTGTCGAGCTCGAGGTCCAGCGTGGAGCCACCACCCAGGTCGTGCAGATGGATGTGGGCGA
CCTCCACGAGATCACGCCGCATCGGTACCTGGAAGTCGGTGGGAGCATCGTGCACTCGCTGTCGTACCAGCAAGCGCGCAACGCGTCGCTGCCCGTAGGT
AGCGTGTACCTGGCTCAAGCCGGCCACATGTTCATGAAGGCACACTTGACGCAGCCGTGCATCATCACGGCCGTGGATGGCAAACCGACGCCGACGCTGG
ACGAGTTTGTGCGCGTGCTCGCCGCACTGCCGAACGGCTACCGCACCGTGCTGCGCTACTTTATGATCCGTGACCGCCACCGTGTGCGCACGGCGTTCAT
CATGATGGATCGCCTCTGGTTCCCCATGCAGATGGGCACGCGCAACGACAAGGATGGCCGCTGGTACTCGGAGCTGTGTCCTGACATGTCGGCGGGCGTC
TCATCCGTGACGTCCATCCCGTCGTTCGCCCCCGCACCGCTGAGCTTTCCCGGCGGCAGTGAGTTGGGCAAACGCCTGCTGCGATCGCTCGTGATGGTGT
CCTTCGACATCCCGTACATGGTCGACGGCATATCGAGCTCGAGCTACCACGGCATGGGGCTCGTGGTGGATGCCGAGCACGGATTCGTGCTGGTGGACCA
GAACACGGTGCCCATCGCGTTGGGCGACGTGCTCGTGACCATCGCCGCGTCGGTCGAAGTGCCCGCGAAGGTTGTGTTCGTGCATCCGGTGCACAATTTC
TCCATCATCAAGTACGACCCGAGTCAGTTGGGCGCTGTCGCATCCCACCTCGCGAGTGTTGTGCTCGCAGACAAGCCGCTGGAAGTGGGCGAGACGGCGG
ATTACATTGGCCTGAGCAGCAACTGGACGGTCGTGACCATGAAGTCGGTCGTGACGAAGATTGACCGCCTAGTGTTCCGCGATTTCCAGCCGCCGCGTTA
CAAGGCATCGAACGTCGAGGTGCTGCACTTTGACCGCACGACCAAATCCGTCGGTGGCGTGTTCATGGACGAACAAGGCGGCGTGAGCGCTTTGTGGCTC
TCGTTCAGCTACCAGGACGCCGCTGGACGGAAGGAAGTGTTCCGTGGGTTGCCTATCAGTGTCGTGCGTCCCGTGATTGACGAGTTACGCAACGGCCAGG
GTCGCATCCCAGCATCCGTCAGCATTCTGCCTGTTCAGCTGCTCACGTACTCACTTTCCAAGGCGCGCGCGGGGCTCGGCCTCTCGGACGACTGGATTCG
AAAACTTGAGGGCTGTTATGACGACAAGCGCCAGATTCTCGGTGTCAAGCGCAGCGCCGCGGGCACGGACTGTGCCAAGAAGTTGGAGAGCGGCGACTTG
CTGCTCGAGGTGGACGGCCAGGTGGTCGTGCGTGATGCAGACGTTGAGTCGGCCGTGCAGGACAAGAGCCACTTGGAGTTGCTCGTGCTGCGCAACCAGG
AGGAGCTGCGCGTGAACGTTGAGACGATCAAGCTGTCGGCCATGGGCACCAACCGTGTTGTGGTCTGGGCCGGACTCGTGGTGCAGGAGCCGCACTACTC
GGTCGCGACACTAGGCTACATCCCCGAAGAAGGTGGCGGCGTGTACTGCTCGCGCTGGTGCTACGGCTCGCCGGCGCACAAGTACGGCCTGCGCGCCACG
ATCTGGATCGTCGAGGTGAACGACGAGCCCACGGCGACGCTCGACGAGTTCCTGCGGGTTGTGAAGAAGCTGCACAACGGCGATTCGGTTCGCCTTAAGA
CCATCGCGATTAACACGAAGCCCAAGGTGTTCACGCTCAAGACGGACTACCATTACTGGCCCACAGTCGAGCTGCGTCGAGAGCAGTACGACTGGGAGTA
CGTCTCACATCCA