Description :
From Genome Similarity Track
Location :
Scaffold_1:1535991- 1538007
Transcript NameFunction/comments
g485.t1RAW23941.1 hypothetical protein PC110_g19626 [Phytophthora cactorum

Sequence
2016 bases(100 bases per row)
CCATCCCCACCAACAATTGGTGGGGCAACATGATCGCGCACGACTCCAATGCCGCCATCCAGCCCATTTGGTCCAACCCGTACTCGCTGCAGATGGTCGC
CGACAAGGCTCCGTTCGGCATGTCCGTCAGCTACCCGTATCGCAGTCGCTTCAGCGGAGGCAGCTCCGGCAACAACGGCGCCGTCAAGTACTACGCGCAC
GGCATGGTTCGCGAGTTCCTGTTCTCGGCCGAGGAGATCGTGTGGCAGAAGCCGAACTTCCAGGTCGTGGACTGGGCCGACCAGGGCGTGACCGTCAAGT
TCGCTGCCAGCTCTTCCAGTGGCAGTATGGTGTCGGACCTGGTCTCCGGAATGGTCTACGCCTCCATCAAGTACTCGGGCCTCACTCCGCGACTTGTGTC
GAGCGCGGTGATCTCCAGTGTTAACGGCCAGTCGCTCGGTGGTCAAGTGCGTGGCTCCAAGTTCGAGATCGTCTACAACTCCGGCCAAAAGTGGGTCGTC
TACGCGCTGTCGAGTGACGGCCGCAGCGAGAAGGAGATCACGCTGACGGCGGACGGCAACTCCGCTCTCAAGAGCACGGGCGTGTTCGACGGTGTGCTGC
GCGTCGCGCTCGTGCTCGACGACTCGTGGCTGAGCACTCTGGACAAGCACAAGTCCTGTATCGTGCAAGCGGCGAATGTTGATCTCCGTGACGACAGCTC
GTACTCGTTCAAGTGGAAGACGGTGGGCGATTGCTCCGGCGGTCTCCTGCACTTCGCCATGAAGCACCATGTCGAGACGATTGACAAGAGCAACGGGGTC
CGTCAAGTGAACGGCATGGTGGCGTATTCGACAACCCGCGGGGCTTATCAAGCTCTCTTGACGCCAGGCGGCTCAGCCGACCCGGTTTGGGAGATCAAGG
AGACCCAGCAAGTTCCCGAGGACTTCTACCCAACGCGCAAGGTCGCATCCAGCGTGGCTCAGCAGCAGCGGATCGCCGACCACCTGCGCGAGGACATCAA
CGGCGCCTGGTCCATTCCGCTCGACGGCAGCTACTACTTCAACGGCAAGGCTGCGCAGAAGTACGCGTCGCTGTGTCTGATTGCCAACGACGCCGCTGTC
GTCGGAGGAGACAAGAGTCTGCTGAGCACGTGCCTGAACAAGTTGCGCGGCGTGATGGCGCCGTTCGTGACCAACGCCTGGACCAACAAGCTCCAGTACG
ACCAGATCTACGGCGGCATCGTCAGCTCGCAGGGCTTCAAGACCAAGGACCTGAACTCGGACTTCGGCAACACCATGTACAACGACCACCACTTCCACTA
CGGCTACTGGGTGCACACGGCGGCCATCATGAACTGCCTGGACCCAAGCTGGAGCGACCTGGGCAAGCTCAACGCCATGGTCGACCTGCTGGTGCGCGAC
GTCGCCAACTCCGACCCGGCCGACAAGTTCTTCGCGCGCTTCCGCTCCTTCGACTGGTTCCGCGGCCACTCGTACTCGCACGGCGTCACGCCGTTCGCCG
ATGGCAAGGACCAGGAGAGCACGTCCGAGGACGTCAACTTCGCCTTCGCCATGTACATGTACGGCAAGGCCACCAAGAACGCCGCCATGGAGGCCGTGGG
CAAGCTCATGACGCGCGTCAACGCGCACGCCATCAAGACGTACTTCCTCATAGAGGACGCGAGCCAGGTGCACCCGGCCAACTTCCGCCCCAACAAGGTC
ACGGGCATCTTCTTCGACAACAAGGTGGACTACGCCACGTGGTTCAGCGCCGAGAAGTACTGCATCCACGGCATCCAGATGCTCCCCGTGTCGGCCGTCA
CCGAGTTCGTGCGCACCAAGCAGTTCGTCAAGGAGGAGTGGGAGCAGGTGCTGGCCAAGGAGACCATCGTCACGCGCGAGGACACGAGCAACTCGTGGCT
GTCGCTGCTGTACATGAACTTCGCCATGGTGGACAAGCAGCGCGCGCTGGGCGTGCTCCAGAAGGCCAAGATGGACGACGGCCTCTCTCGCTCCTGGGCA
CTGTACATGGCCGCCA