Description :
From Genome Similarity Track
Location :
Scaffold_53:153584- 154691
Transcript NameFunction/comments
Phypa_INRA-310PPTG_16062hypothetical protein

Sequence
1107 bases(100 bases per row)
GAATATATGTTAGAATCCTTGAAAAATCCTGGTTAAAATCCTGGATAAAATCGAAGAAATATAGTCCTAAAATAATCGTGGATAAAATCCATCATTTAAT
CCTGGATAATTTAACAGATAAAATCTAAAAATAGAAATCCTGGACAAAATCCTGGATCTAAAAAAACATGGATATAATCCTGGAACGGAAAAATCCTACT
CACCGGTTGGTCTTGTGGCTGCAATCGACGAGGAGAACTTCGCTGAAACGACCATAGATACGCCGCATGTGAGCGGTAGCCAGTGAAATGACTCCTGTTT
CACCTGCATCCGTTTCAGACACTAAGGATAGGTTCTCCGGGTCCGCTGCAGCGAACGCAGCAATCTCGCGCGCTGTAGCCTCGTTATCATCCTGCGTAGA
GAGAGAGCCTGAGTGGTCCCGGACGAGATTATCAACGTCAACTTGTATGACGTTTTGGTCATGCTCCAGTAAGTAGTCGTAAATGCGAGAGCGCTTAGCT
CCCGCAGACAGCATGCCTTCCACACGCGCTCCTACAACCGGATCGTGAACTCCACGCGAAACTGGATAGGTCGCGTACGCTTGGGTTGAAACTTGGTGAT
TGTGGGTGTACACTCCATTCTTCACTTGTAGTTGCTCTCGAGCCACGTTCCATTGAACCACAAAGCGGAAGGGACAATCCGTCAAGCGAATGTGCTGGCG
AGACCGCGTCCCTTCGCTTCGTGATTTCCGCTTCTTCCAGCCATGAGGGCATATGTACACTCGTTGATAGGGATCGCAACCTTCAGGTAGTAATATAGAG
TCATCATCTGCTTTCTTGGTCTTCTTCAACCGCTTCAGTCGCTCAGCCCGAGACATGGTATCCTTAACAGGTAGAACCTGCCTCGTTCTCTCGCAGTACT
GTACGAAGTACTGCTGCCAGGCGTTCCAGGACGGATGCCACACAGCTGGCGGGTCCACATCCACAGAATTACCGCTCTCATCGTTGTCTCCAGACTCCAT
GGACACCATTTCGAAACCAGGTGTCTCCTCCCTCTCGCTGCCGTCACCACCTGCCGTACCAGAAGCCCCTCCACCCGTTGTCTGGTCGTCTCCACCAGCT
TTTGCAT