Description :
From Genome Similarity Track
Location :
Scaffold_1:1535642- 1544256
Transcript NameFunction/comments
Phyin_T30-4PITG_00254Mitogen-activated protein kinase%2C putative
Phyin_T30-4PITG_00255Putative uncharacterized protein
Phyin_T30-4PITG_00256Putative uncharacterized protein
Phyin_T30-4PITG_00257Putative uncharacterized protein
Phyin_T30-4PITG_00258Putative uncharacterized protein

Sequence
8614 bases(100 bases per row)
CTTCACATTTTACATACTCAAACTAACCGACTTTTACCACCGGCCGTTTGTTGCTTCACCCCTTCGTCTGATTCCATCTTCATTCCCGCAAGCCGAACAC
GGACCAAGTCGAGGCTCGCCCCGTCGCGGTCGAACAGAGCGGGAGACTTCATTCATCTCCGGTTGTTTCGTTCCGCGAACAGTTTGATTTCTTCAAAAAT
ACGGGCTGTATAATTCACAAAAATGCGTAAGTATCATGAACTTAAAAGAAGAATTACAAGTCACACACATACCTTTCAAAGCCTCCTTGTTCAGAGGGAC
ATTCTCAAACTCCATGCCAAACGGATTGCCTTCTACAGTCTCCGACTGAGACCTCCGTACTGACTCCAGGAACGGGTGCGCTAGAGCTTTATCGACCTGA
AAAAATAAAACAGTCAGATAAAAACCTACTAGAATAAAGTAGTGTAGAAGCTGAAAGACTTACCGAGATTCGGCTCTCGGGGTTAAATGACAGCATTTGC
TTGAGTAAGTCAAGCGAGTCAGCAGGAGCGCCAGGGTACATCTGGATGGACCGCAGATATACAACCAGGTCAGAACATGGCTACAAATGCGAGCTTAAAC
GACGCAGTACATACCTCGCGAAGGTCTCTGGGCTCCTTCTTAGGCAGTTTCCGCAAGTACTGTTTGACTTCACCCAAGCTGCCAATATCGTCCTCGCCGG
GTGTGCCGATCACATTAAAAATCACGTTGAGCTGGTCCAGCTTGTCTGAGTACGTCGTGGGACGGTCTGCGCTAAGAGGGAAGCATGAGCGGCCAGGAAA
GAGAGGCACGCGCTCCTGGTACCGCGGACAGCTCTCCACTTGCATGCTCAACAGCTCGGCAAAAATGCATCCAATGCTCCACATATCGACAGAGAAATCG
TAATCCTGAAGGAGAATCAGCTCTGGTGCTCGATACCATCGAGTAACAACGTGTTTCGTCAACTGTCGTCGCATCTTGGGGAATTCGCCAGACGACGAAG
GCGTAGAGGAGGCGCTTCCAGGAGAAGGTGCCGATGTGGTTCCTCCGTCAGATGTGGTGGGCGACTTGGAGTCCTTCGGAGAGTACAAGTGCTTGCTCAG
TTCCTCCATCGACATATCGCTCTCCATTACACGAGAGAGGCCGAAGTCGCAAATCTATTTTAAATAAAATATTTTAAAATTAGCAAATATTTCATTAAGA
AAAAAGTATTTCTTTTGAATGTCACTTACCATAAGGGTGCAGTCTTCGTTCAGCAAGATGTTGGCGGGTTTCATATCACGGTGGATCACGTTGGCTGAGT
GGACGTATTTCAGTCCACACAGAAGTTGATACAGGAAGACTTGGATGTGACGAATGGTCAAGTACTGCGGGCTCATGATGAGTTTGTGCAGGTCAGTGTC
CACAAAGTCAAACACCAAGTACAGATCTGTAAAAGTGTCGTAGTTCTCCGGCGGGATCACATCGATCAAGTTGATCACTTGCGGGTGGCTGGTAGCAAAA
CAAAACAGCATTTAAATCAGCACAGCATACTAAAGCATTATACATTACATCTTCCACATACCTCAGACGACGCAAAATGTAAATCTCGCGGTACAGTCGC
TTGCAGTCGATCTCCTGGTCAAAGACGTTGATGATCTTCTTAATGGCCACTTTCTTCTTTCGTTCGTTATCGAAGGCCTCGGCCACCTAAATAGGAAAGA
CAGATCAGAGACTCGTAAACAGAAAAAGAAAAACCAGGACTGATCTGTACCTGTCCGTAGGAACCTTTGCCGAGCAGCCGCACGAGCGAGTATCGGGTGC
CGACTTCCCAGTTGGCGAAGTTGCGGAGATTGAGTGGTGCCGCGCGAGGAACAGGCGACGGCGTGGGCGCGTGTGAGGAGTATCCGTTGGTCGTGGCGGC
CGTCTGGTTGTCGTCCGCAGGCGTGGAAGCTGAGCCGGCTGCCCGCTGCGCCAGGGCGCTATTGGATGGGAAGCCTTCGCTAGGCGTGGAGGAGAAGCCA
TCGGGCGTGTGGCTAAAGCCGTTACGGTTGACAAAAGCAGGGGTAGGCGGCATGTGGTCCACCGGCCCATGCGGTGTGGGCGCTACGGCGGCGCTGAACA
TGGCACGCTGGTGGTCGATGAACTGGTCCGAAGTGTGGATGGAGCCTTGCGGCGTGATCACGGGCGGTGTCACGCCATTCAAGATGCTGGCGCTCGGGGC
GGCGGCCGGTCGCGACAGCTTGTGGCCGCGCTTTAGGCCGGACGGCGGCGTGGAGGCCGTCATCTTGCGCTTGCGGTTGCCCGCGTCGGTCATGTCCTTG
GGGGTGGCGGTCTCCATGGCGTGGGCAACAGGAGTGATGGTCAAAAGGGGGAAAGGAGGATATGAGCGGCAGTGCAGAGTGAGTTTGTGGTGTTCTTTGA
GTTAGTCAACGCGTTCCGGATATCGGCGCTTTTTGCGTTGTGTCTTGCTCTGCTCGCGGGTTTGGGGGTGGCGGTTTGGCCCCGCTCTCATGAAAACTCA
GGCAGATTTTTTTATCCAATAGACCGGTGCGCTAAGATGGTTTTCAGCTAATTGAGAACCTATACGACTTTCAGCCAATGTGCTGCCGTTTCACATTTCC
CTCGGAACTGACTCCGACAAAAGGCAAGAGGCGACACCAAATATAATACTGTGACCGCCGGTCACTGACCGGCCAACGTGCAGCCGCGACTCGCGGGGCG
TGAGCCTGTCCTGGGTGTGACGTAAAAAGTTGTTTCCTTACCTCATCCGTTCGTCTAAAGAATCACTGGGCCTATAAACAACTCACCAGCGTTGATCGTT
TGAAGTGCACCGTACACTCTAGTGTCGGGTGTTGCCTCCGAACTCTGTTGGCGCTACATTTAATGTAGCGCCAACAGACCCGGTCGTAGTACAGTACTGT
ACAGCAAATTTTGCTGTTGAAGTGCTTGACAGCTTCTCCGCCATCTGGCCAACTGAGTAGGCCAGTAGGCCCTGACCTGCCTCAGCTTCGCGACTTCGAA
ATACTTGTACATGTAGTAAGCCATAAAGTCTTTTCTAAAGCGAGAAATGCATATGCTGTCGAAGAGCATCCGGCGTGTGTCGACCAGCGGAGAAGAGAGA
TCGCATTATCAGGCAGATGGCCACAACTTTTGGCGACCCCATGGTATCCTATATCGGTGGGGCACACCATACACGAAAGCTAAAACTGTCAAGGGTTACT
TTCGGCAGGCAGCACTGATTTCTATCCAGCAATAAATATTTTAAACTAGCGTGCGTAAGCCCTCAAAAATGGGCGGCGTCCTGTGCGAGGAACGCATCGA
GGTCGTCCAGGTCATCATCCTGCGTCTCAATCGCGTTTTCTCGTCGGCGTTGCGCCTCCTCGGCCCTAGCTTTGGCTTCCTTTTCATCGTGCTCGCGTTT
CGCCTCCGCCATCGCAAGTCGCACCCGCTCCTGCTCCTGCAACTGTAGCATGCGTGCGGTGGCAGCTCCAGCATCGCGTCGGTCGGTTTGACGCTGTAAA
CGCCTCTGCTGTTGCTCCAAATGCTTCTGCTCCTGCATCAACTGACTCAAACGCTCTTGCGTCAGCACCTTCAGCGCTTGTACCTGCTGAAGCTCCGACT
CCAGATCAAACAGCAGCTGCTCCTCCACATACTCCTCGTCGGTCTCAAACCGGCGCTTAATCGTCGACGCTCGCCGCCCGCGGCCCTGCACCTCCGCCAT
CTCAAGAGTCGAGTCAAGAGAAGTGCCTGATTCTGGTCCGAGAGGCTGGCACCGATGCAGTTTGTGTGGTACACCTTTTTCAAATATCATTGATACAAGA
GCGAGCCAACATGGTTGACGAAGAGCCTTCTACCAAGGCCAGCGGGACGGCGGAGCAGAAACTCTATGTACTAAATGCACTCCAAGTTGTGGATGAATGG
TCTGTGCACGACGACGGCGACGGGCGACTATTCTACTACGATCATAAGACGGACTCGTCCCAATGGGAGGTCCCCGACGACCTCGCGTCGCTTGAGACGG
AGTTTATGATGAAGCTCATGCTGGAGAATAACGTGGCGCGCTCGGGTGTGTGGACAGCACATAATGCGGGTAATGGCACGCTGTATTACTTCAACTCGAA
GACGCGCGAGTCAGTTTGGGAGCGTCCACACGAATGGGGCGAGGCGGAGGCTGCTGCAGCAGGGGCCAAAGCAGCTCGAGAAGCGCGAGAAGAGGAGAAT
CAACGAAAAGACAATGACAAAGCTGCTAAAAAGGAAAAGAAAGACAAGAAGAGGCAGAAAAAGCATAAGAAACAGCAAGAGAAGCGAGATATAGACGGGG
GGCAGAAGGACGTGGAGGCGAAAGTCGAGCAATCAGCAGAGCAAGTTGAGGAGGAAACGCCGTTAACAGCAGAGGAGCTGAAGGCAGAAGAAGAGCGCAA
AGCTCGTGAACAAAAACGCATCGAGCAGTTCCGAGCCATGCTGCGTGACAAGAACATAATGCCTTTGACCAAGTGGTCGGTAGCGCTGCCACAGATTGCA
GGAGATCCACGGTTCATGGGCGTGCCAACTATGGATGAGCGTCGTGCCATTTATGAGCATTTTGTTGCGCATCGTCGAGAAGATCTGAAGGCTGAGAAGA
AGAGCAAACTGAAGCTCGCTAAGAAACAGTTTACTGAGCTCCTACATGAACAATTTCAGCTCGATTCATGGGAACCAAGCACCACACTGAGCGTTTTCCT
CTCGACGCTGGAGCGTCTTCTTGATGCTGAGCGGTACAATCAGATTCAGGAAAATGTTCTAGCGCTATTGACATTATCAGCGCAAGAGAAGATTTATGGT
AAAGCAGTAGCAGATTATAAGTCTGAAGCGCTTAAACGCGATGGAGAGCAGCTACGTCTTACCAAGTTCCTGGAGGAAAAGATTTCTGCTCTTGACAAGT
CGACGATGAAATGGGAGAGTGAGGAAGTCCAAAGGCTTCTCCGTGATTTCTACAGTTCAGCAGCTTCGAGTGAATCAGCTGCGTTGCTCTCGAAGCAACA
GCAAAAGCAGGTATTTGAAGAGTTAGTAGCGCGACTTACTCGCACCCAAGACGCAACACCGGATAAAGGGGATCTAAAGGAACCTCAGCGTCCAGATCCG
CGACGTCGATCTCAGTCGAGTGAGCATCGCGGGTCGAGTCCACGAGAGTCACGTCATTCGCGTCATGATGATCGCCGTCGGTCTCGTCGACGTAGGCGCA
GCGACAGTCGATCACACTCTCGTGGACGTGAAAGGATCCACCGCAGTCGACGACGCTCTGTATCTTCGTCCCGATCTCGCTCTCGCTCCAGGAGATCTTC
CCGACACCGGCGTCACCACTCGTCCTCATCATCGAGATCTCGCTCGCGAAGTCGCAGATAGTTGAGAAAAATATGGAGTCAAAACTTCATGAAGTACTAT
ACGTCGTGAAGGTTGAATTACTATTGACACGTCCAAAACTGAGTGCTATTTGCTGATATAGTCTAAAAGATTCTCTTCTTGGGCGCCGAGCCTGGTAATG
GGGAAAAGTCCACGGTCCGTAGCACGTATTTTGGCTCATCAACAATCTTCATGACTGCCTGGACGCCGTAATCCAGCGGCACTGAGTAAATGCCATCGAT
GTTGACTTTCATATCCCATCCGAGAGACCGCATGGATACTCGTCGTGCTTTGCCTCTGCAGTAACAAAACCCACGGCGTTAAATCGCGTTAGCAATCACT
ACATAAAGTGATCGATGGCAAGCAAGACGAACTCACCGTCGAAACCTGATATCGCCGAACGTAGCATTAATAATCGGCTCGCGGACAACATATCCCATGT
CTCGCGAATCTTCTGGGAAAACGTTCTGCTTGTTAATACTACGCAAGGAAGCACAGCAAACGCCACGGTGTTAGTTCCCCCACCTTTGACTGGATAGGAA
GAATACCTGTACTTACGATTCTGTTAGCTCCGTCACTGTCTCGTTTGTGTGTGTGTGATCCATAGCACTAAGAACAGTTGCAACCTGTTCTCGATAGATT
TGGCACTGGAACAAGACAATTATCAGTCATTAATCGCGGACTGCTGCAAGGTTTCAGCTCCAACGTACCGCACTGGAGTACCATGCACTCGAGCCTGTGC
CTGTGCACATGAGAATGCCACTGCTACGATGGGATTCACGCTGGTGCTGGTCGATTCCGATGTTGTAGTGTGACGGTCGAGAGGCGTCACTCTCTGCAAT
GAACACTTCGTTCAAAGCGTAGCGAGGCAGCTCATACCAGTAGCCATCTTGATTCACCATACCGACACGGATACGCTGGCGTAGTCGCCACTTATAGTCG
CCTTCAAGTAAACGATCCAACGCAGTACTAAACCGGTGCGTAACGTTGTCCACCTTGTAGCAGCACAGATTTCCTTCACTTCGTTTTGGATCTGTGTTCA
AGCCTGCTACAGGGATTGGCGTGTTTACGAAACTTGCGGTCTTCAGAAAAGTCCCATCACCACCAGCAGAAAAAATCATGTCCGTGCCCTCCACAGCTTC
ATGTGTTAGTTGGTTGGCAGAGACGACCTTCACTTCGATATCACGTTCCTTAAAACTATAGTAGAAAATAATCCACTCAAACGTTAGAAAGGTGATATCA
ATAAACCATGCGGTACTCTCGATGTACCTGCTGGTAATCTCGTCCACAGCCTCGATGTGATGTTCATGACTCGCCTTCAAGCGGTCATGAACAAATCCTC
GCATGGACATCTGCTTCCTCAAAGCTTCACTGGATTTCGGATAGCAACCCAAATCAGCACATTCAGCGAACATGAAAAGCACAGTCAGGTGCGGACACTT
ACCCGGTATTGCCGTACAGCTCTGCTTCGTGCTGGAATCGAGACATCTTCTTTACCACAACCACCTTTTTCAGGTTCAACATGGGTTTTCCGGGAATCAA
AAGCGGCGTATGATGCTCTTCCTTCGTTGGCGATTCGTTCGTGGCAACGGGTTCCTCGGTCGATTCTGAAGCTTGGTTCAAGCTCGTAGAATGCGAGAGC
ACGTCGGGGGTCACCTCTCCCTCCGACAACGTCTTTGCTCCATTATACGTCTTCTCAAGATACTCTTCTGAAATAATCATACGGGGAACACGCTCCGCTG
TAGCTAGTAGCAACTCGTTGTCGTATACTGGTCGGTCGATCTTCATCCATCCTTTGGGACTGAGTTTCTCGTTCCAGGGACACACCGAGCGCACATGCGT
GAAGTACGGCGCCATTTTCCCGGTCAGCGGGTCTTTCCTGGTGTAATGCAATATGTGGCCATTGTGGATCTGATCCACCATGCGGCCTGACTCCTGCAAC
TCAATAAACGTATCTTGTGACATCCTCTCGAGTCTTGTGCGCATCGCCCAGATCACTTCACCATGAGCCACAACAATAGCTCTTTTCCCATGACATTCGT
GGTTCAGAATACCGAGCAAGCGGTCGGCACGTTGCGCGACAGCGGCCAATGATTCGCCTCCAGGTGGTGCGTAGTAAAAGCGGTTGAGCTCTCGCCGCTT
GAGCTCATCCTGCATCTTGATGAAGCGCTCCTGCTCGCTCATGAGGTCCATGGCGCCCCAGTCGCGCTCACGAATGAGCATCTCGGCGTACCAACGCGCA
CCGGGCAGTCCCATGCGGCCTGCCGTCTCCATTGCGCGTAGATACTCAGATACGAGGTAACGGTCGAAGTGTGCCAAGTTGTTGCGCTTGAGCCAGTCTC
CAGCGGCTGCGGCCTGCCGTCGACCTCGATCCGTGAGCCGCCAATTGGAGCTGTGACGGTGCTTGAATTCACCAGCGAAGAGACTGTGGTCCCCGGCCAG
GGACCGCTGGCGAGCCACATTGCCCTCGCTCTCACCGTGGCGAATGAGCACCAGATCGGATAAGCGAGGTAGGCGGTCGATTTTACTGCTAGCAGTACTA
CTGCTGCTGCTGCTCTTGCGGACACAGAGCGCACGTACGGCGGGCAGGCGGCGCGCGCGCGTCGTCCTCAACATGGTGCTGATCGAAGTGCTGTGCTGCT
GCGACGTTCGCAACTGACGGCGAAGAGGTCACCCTCGGTAAAACTGGATGAGGACAGACAGGACGTCTATGTATGTCACATAAGCACAATAGCCAATCAA
CGCGTGTTAATGAAACCGGTAATCAACGAAGACCTACCGATGATTATCGGTGTGCGACGAGGAAGAGGGCAGCTCGCTAGGAGCAAAATGTGTGGCACCA
ATCGTGTTCTTGTATGTTGTCACATTTTGAGCACTGGTAAAAATGGGATGGATTTGGGATCGGTGCGCACAGAAATGCATTGCAAGCTGTCAATGACGAC
AGTGTCGTCACGACACCGCATCGGTATTACCGGTATACCTGAGCGCCAAACGTCGCACATTGAAGTGAGTGAAGCGATCTCAACTCGGTAAAATGGAGAG
CCTCGATGTTGGGTACGCGCTGCTGAGCGACGTGAATGCCCGCAATCGCGAGCTCCAGGCGCGCTTGCGAAGCAGTTTGCCGCTGCTCTGGACAACTAAT
GCGCTGGTGATGACGAACGCCGCTGGTCCCAGGAGACGGAAAGCAGCAGCTGAACAGTGGGCAGTAGGAGAAGCGGACCAGATGCTCATAGCTATCGAGG
GGCAATCGAGCTTA