Description :
From Genome Similarity Track
Location :
Scaffold_32:153501- 179477
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G010768Protein of unknown function
Pytul_DAOMBR144PYU1_G010767Similar to Lrrc40: Leucine-rich repeat-containing protein 40 (Mus musculus)
Pytul_DAOMBR144PYU1_G010766Similar to corA: Magnesium transport protein corA (Thermotoga maritima)
Pytul_DAOMBR144PYU1_G010765Similar to nadA: Quinolinate synthetase A (Synechocystis sp. (strain PCC 6803))
Pytul_DAOMBR144PYU1_G010764Similar to Tulp2: Tubby-related protein 2 (Mus musculus)
Pytul_DAOMBR144PYU1_G010763Similar to Slc47a2: Multidrug and toxin extrusion protein 2 (Mus musculus)
Pytul_DAOMBR144PYU1_G010762Similar to Slc47a1: Multidrug and toxin extrusion protein 1 (Rattus norvegicus)
Pytul_DAOMBR144PYU1_G010761Similar to IFT122: Intraflagellar transport protein 122 homolog (Homo sapiens)
Pytul_DAOMBR144PYU1_G010760Similar to KIF4B: Chromosome-associated kinesin KIF4B (Homo sapiens)

Sequence
25976 bases(100 bases per row)
AGATCTCGGCGACGACCACGCTCAGGATGCCGCCAAAGGCTGCGAGTCCCAACAGGAACACGTAGACGTTGACGGCGTTCGTGCGCTCGGCCTCGCCCAG
CGTCGCGTCGTCGCGCTGGATGCGCAGGTCGTACTCGCGGATGTAGTTGACGAACGCCAGCGCGAACAGCGCGAGCGACGTGAGCACCCAGCCGAGGACC
ATGTACGACTTACGGTGGCATCCAAAGATTGGGAACACGTCCGAGCAGAAGCCCGTGATGAAGCTACACGCCCAGGGCAGCGTTAGCAAGATCTGCGCGG
CGTCGAGCTGCGCTTGCTGCAGCTTCAGCTCGGCTTTCATCACCGGCAGCAGGCCACGCTTCAGCATCGACGTCAGCAGACTCGCAAACATGAGCGACAT
GAGCAATCCGATGTGCTCGGCGCTAAAGAGCGTGGCTTTGTGCGTCTTTCCCCTGCGTCGCGACCTGTGACGCTCACATCGCGCATCGTCATCGTTGGCG
ACGTGGAGAACGGATACCTTGGCAGGGCTCAGTTCGATATGGATGCCCTCGCCAAACACGTCGCCCGCCGTCTTCGCTGCCGTCGTGCTTTTCACGTGGT
AATGCGCCGTCGCGCTGCTCGCAGGCGTGATGCCGAGTTGCGACTGAGCTCCATGCTCCGACTGGTATGGTGAATCTCGGGGACCGGCAAGGGCGGCTCT
GTCTTCAGCCAGGGAAGCCTCGGTCGCCATGCTGCTTCCGTTGTCGCTCTCCTGTCCGCTTGTTCGTTGACTCCGCCTGACCTGCTGATTGGCGAATGAG
CGGCTCAAGAAAGGCGATACGTCCCACCCGCCTTCCTCCCTTCTGCTGCTGCTGCCCGTGTTGCTACGTGGTAGGATAGACGGGGGCGTGGGTGCGCGTG
ATGCGCTTGCTGCGGATGTGTGTCAGCATCTTTAGAGTGGTTTATCGCCGTCAAGCGTTGAAATCGTGCACTTGGGATTTGCGCCATGCGGTCCGACAGC
ATGTTGCTTGCCTGCAGCGATCAAGGTGTGTCACGAAAACAATCTACCAGTAGATACCGGTACCTGATCCGAACTGATACTGGTAGTACTATTGCGTCTA
TCCGCTTAAAAGAGCCGTGACTTAATCCGGATGGTGACTTTAACAGTCACACGCTCACCACGTCAAAAGTGTTCATCACTTTCACCAAGTAAACACGACC
GACCGACCCGTCGTCCGTAATCGAGTGACTTGACTTGACACATCCGGATGCCGATCTCAGTCGGTTCGCTTATTCTAGCTAATGGTGAGCGGTGGATGTC
GCAAAAATAAATGAGCAGCATGCGCACGTGCCGTGATCATGTATTCCTCATTTTAGCGCCGTGAAGAATTCATTCGCACATGCACTAAGGTACGCAAGGT
TTGCTATATAAAGGAGGCGCTTTATGTATCAACACCGCGTAATCGTCAAAGGCAAGCAAGCCGTTTGTGTGCATGCAAGTGACGCAAGAGAGGCGGGCAC
GCGCAGGATCGAGGCGACTCGCGCATTTCCACTCTATGGTTGTTCCCTTGACGCGGTCATTACCGACCGTAGATGCCGTGTCCGCACAACGCAAAGCGGA
GTTCTGCGCATGCCGTTGTCACGCGCACAATGCAACGCCGGTTCTTCCCACGTTGCGGTCCTGCTCATTATTGTCGTCGCCTAATCCAGTCAGATAGAGA
GAGGCGCACCCATGGCGCCCTTATCCGCCTCTTGTCGTGCGTATGGAATCCATAGAAGGATGTATTTTCTGTAAAGAGGTTTTGTTAGTCGTCAAGATGA
TGCTTTAATTAGTTACACAGGTTTATGCGCGATATCCAGACCACTCTAAAACGCTTTGCGTACAGTTGTCCTTGTTTTTCCTAAACCCACAATCGACACT
CACAAACCTCTTTCGACACATCACTCTATAATTCTGTATGTTACCTAACACTAGGTTCATTCATCGTACTTTAAAAGCATTTTTGCCTCCAATAAATAAT
TTGCATGTCTAATATTATAAGCAATCACTGAAACGCTGATTGCGACTGTCTCGTCGCTATGTCGCAGAAGAAGCGCATCCTCCTGCCATCCGACTGTGGC
ACATGGCGATGCGCAGCCAATTCTTCCGTGCCAGACGCATCCTGTAGTGTGGGCGTGCAGATAGAGGCTGCTCGCTCCCCACAACCGGCCCTTCCTCCCG
CACCCATACGCCCCTCCCTCTGCCCAAGCAACACCGCTTGCATGCGGGAAGAAACGCCGCCGTCCGCCGCGCATTCTCCCGTTCCTTAACTCCACTGTTT
CCATCGGCCCCGCCAGCGCGCAAGACGATGCGATGGCGGCGGTCGTGGGCTGTTGGTCGACTTGGCAGCGCGATGGCGCTGTTGGTAATGGCTGTGGTGA
CGTCAGCGCTTGTCCGATTCAGTGAAGCGGATGTGCCACCGCCGCGTTCGTTGACAGTGGTGTCGTGCAGCGAGATGTGCGCCGACGTGTTCGCTGCGCA
GAGCGTGACGACCGGCGCGTGCGTCAACCTCAGCGACGGCACCGAGAACGTCGATACATGCAGACAAACGCGTCAACTCGACGGCGTCGCGACGTGCGCC
TCGTTTGCGAATGACACTGAGAATGTCGCGCTGTGCATCACGCCCGTGGCTAACGCACACGCGTGGAACTTCCGCTTCACGGCGAATCCGGAGCTGCTCG
CCGTGGCACATGCGCAGAGCCGCGCGCCGCAGGTGATCACGCTGGACGCGGCGAGCGTCACGTCCGTCCGGGACTTTGTCGTGCCCACGAACGCATGGCA
GCTCGTGCTGCAGCCTGCGGATCCAAGTGAACAGCTACAGATCGCTCTCAGCGCCACGACGATCCAGCAATGGCAGAACCTCGAGACGCTGTACGTTGGC
TGCTTCAATATTCAATTGCGTAGCATGCGCACATCTCGCATGCTTATAGCGTATGTTGTTGTTGTGTGCGTAGCGTGATCCAGAACATCGATCTCTCGGG
CATCGACACCATGACGGCATTCCCCGAACTCACCGCTCTGTGCGTGCCTCTGCACGCAGGTTGATCTGGAGCTACATGGAGTTCTCATGCGACGACTAAT
CTCGTGCTTGCGTATGTGCACAGGACGCTGACGGGCGTGTCGATATCCTCGTGGCCGCTGATGACGACGACGGCTCTCACGCAATTGTACGGCGCAGGGT
TTCGCTTAATCATGCGCGGCATTGGCATGTTGGGGTGTATGCAACTGACGTGCATGTGTGTCTTGCTTTGCTTCGCGTTTGCCCAAATAGAGACCTGTCA
AACAATCGAATAGCTACGCTGCCCGCCAAGTCGCTCCCATTCAACCTTCAGACCTTGTAAGTGAGTGTATAAAGTACAGACTTCTCTTACTGCCCACGCA
CTGACGACCTCTGTTCGTTGTTTAATCCACGCGATAGAAACCTCACGAACAACCAGTTGGCTCGATTCCCAGTCGACATTCGCTCGATGAACTACCTGAC
GGTCTTGTACGTTGCTCGTTGGAGCTTCTCTAGTTATTATCAGGAGCGTAAAATACTCACTCACACTTACCGCATTGTATGGTGCGTGTATCGCCAGGTC
GTTGTCGTGCAACAATCTCTCGAGCCTCACGTCTTTCCCGATGCTGTTGACACTAAAAGAACTGTTCGTGGAAGCTCCCTCCTTTTGTCTGCTTCAATGT
GCGTTCTAGTGTGTGCATTTTGTCACTAAAGGATCGATTTGTATGCACGCCATCGATCTAGGTACTTGGCGTCCAGCTCGCTCACGACGGTTCCAGTTGG
CCTGACTGTGCTCCCAGCGATCAAGATCTTGTACGTGCAGTGAATCATCATGGCCTCTTCCTTAGCTCATGTGCCACTCATTGCTCACGTTTGTCCTTTT
GGGCAAGCAGGGACTTGTCTGGGAACACGCAGCTGACAATCCCATCCAACACGCTTCCAGCGTCGCTCCAGGACTTGTACGCGCTACTCAACGCTGTCAA
CAGTGCAATTTCATTGTCTCACAAGACTACTACATGTTTTCACTTTATTTAGGGTATTGCGAGACTGTGGCGTCGTCCGGATCCCAGCTGAGTTCCGCGG
TGAAAAGATGTGGCGATTCATGTGCGAGGGTCCCTTGATTTCCATTTTTATACTGCATGCTAAGAGGTCTAACCAGCCATTTATGGCTTTGTGCGCGTCT
TGTATCACACGTAGAGATCTCAGCGACAACCCGATCAAACCGTCCGAGTTGACGACAGTAAAGTTCCAGACCAGCAGTCTGTATGCGAATCTTCCTGCGT
TTGTGAGTTGCACGGGCCTGGAAAATGATCTTTCTCATCAGATGTGTGCATGTCGAATCATTGTTGGTGCCCAGGCTACTGGAAAGCATATTTATGAGCG
CAATCCCAGCGATCGCGCGCAATTGGACCGTCACGTCGACGTTGTACGTATAAGCGCGCCATGGATTCTCCATACTCGTTTTCATAGAACGGCAAAATGC
ATATGAATGGCTCTTGTTATGTTTTAGATCCCTTTCAAGAAATTCATTTCAGAGTATCGATGCAACGAGTCTCCCACCAAACATCACCGAGCTGTACGTG
CCTTTCCAAACTGCAGCATCTCTTCAATCACCTGACAACACATGGACTGCAGTAGCTGATGCTTCATTCGTACTCTGTGAATATGCAGGCGACTGGAAGC
AAGCGGCTTGATCACATCGCCAACGAATTTGCGATCGCTAACGCAGCTCAGAGTTCTGTACGTGACCAACTTGTGGTTATGCTTTGCTAGGCTTTACAGA
TGCTTTCCTGGTCTGCACATCTTGTAGAAAGCGATCGAATTTACAAAAATCCGTTGTTTGTACACTAAACAGATCGCTATCACACAACGCAATCCAAGCC
GTGCCGCAGTCTTCTTTGCCGAAGGAGCTCGTGGAATTGTATGTGCTACCAGCACCTTTGTTGCCTGTGGACGCCTATGCTCATTATGTGTGTGTGTGTG
TGTGCTTCTTATAGACGCCTTTCCAACTGTTCGCTGGCCGATATGCCGAATGATATCAACGCCATGAGTTCGTCCTTGCGAACACTGTACGTGGGCTCGC
AATGTTTTATTTGTTTGAGTGAATATCCCCATATCTAATTTGAAAATGATTTTTTTTCTTTTTCTGCAGCGACCTGAGTTTCAATAGCATTAGTAGTATC
AACGTGCTGAGCTTTGCGCAGCTCGAGAAATTGTAAGACATGCTGATCGTATTGTCTGTCATAATAGTGCATGACAACTCACATTTATTTCGTCTTTGTT
CGCTTAGGTACTTGCAGAACAACTCGTTGACGACATTTCCAACCGAGATCTTCAACCTGACAAAACTATTAACATTGTAAGTACCCACCATATCCACGCC
TCCTTTTACAATCACTGCGGTTATGGAAATGACATCGTTCTAATGCTTTATGTGGCCACTAGGGACCTGAGAGGCAACGAAATCCGCAACCTCTCGTTCA
CACAAGATCAGGTGGCGTTTCTCTCCACCCAGTTGCAGACGCTCGTGATCGATGCCGCCGCGTTTTCCAGTAACTGCCAAGACAAAGTGGTGTTGCGCGG
GATGTACTCCATTTGCTTACAGGACTCGATTGGCGGTAATGACGACGACGATGACGTGCCGACCTCGAGCGCAGATAACGATGCGTCCAACACGAAGCTG
GTCACAGCGCTCATCATTTTCGCAGTTGTCCTCGTCGTCGCGTCGTTCGTTGGAGGACGCAAGTACGCCCAGCGGCACCGTTATCGGTTCGACGACGGTC
TTAATTCATCGAGACACGGCGCGACGCTGGATTCGACCGACGATGATTCGCTGCAGCAGTGGCGCATCAACGCCGAAGACTTACTGCCGATCAAACGACT
CGCGACGCGTCCGTATGGAACCGTGTGGCTCGCGAGCTTTTACTCCGAGACGGTGCTCGTGAAGCGAATCAACCAGAAGCGGATCAGTGCGAACGCGCAG
CTGGATTTCATCCGGAAGATCACGGTGCTCGGGAAGTTGGAACACCCGAATATCATTCGTCTCATTGGAGTAGCGTGGACGACCGAGGTGGATGTGCAAA
TGGCGCTCGAGTACATGAGCACGGGTAACCTTCGACGCTACCTCACGCTCACAAAGGACGATCCAGTGGCAAGAGAGTGGAATAGTCGCAAGCTCTCGAT
GGCGCTGAACGTCGCGCATGCACTCGTGTATCTCCACTCGCGACGCCCGCAAGTTCTGCATCGAGATCTGCGATCACGAAGCGTACTGCTCGACGCAGAA
CTGACGGCCAAGGTGTCGGGCTTTGGTCTCCGTCACTACAAGTCCGATATCCACACCACAAATTCCCAAATGGCGTCGACTCCGTCACGTGCCTCATCTG
TCAATAAAAGCAATCGATGCATAGCTCCAGAAGTGCTTGCAGGAGAATCCGAGTACACCGACGCGGCGGACATGTACGCGTTTGGAATCATCTTGTCCGA
GTTGGATACCCACGAGCTCCCGTTTTCGGACGTGAAGCTCTCAAACGGCAATCCGCTCGACGAACAGTCGATGCTCGAGCTTTTGACCGCCGGTGCGCTG
CAGCCGACGATTTCGGCGCAGTGTCCTCCGGAAGTTGCCACACTGATCCTCGACTGTTTGTCGCTTCTGCCAGAGCACCGACCGACTGCCACAGAAGTCG
TGAATCGATTGCAGTCGACGATGGACCATCTGCTGCGGTTGAGCGAGGTTGGCGAAGACATCTTGTCGTCACAGGAGAGAATGGATTCGTTCCTGGGGGT
GGACACGCGCAGCTACCGGCAGAAGTCGAGCTCCAAGTACAGTTTCCGCCAACTCAACTTCTCCAGCGAAAAGCTCGAGCCGCCACGACACATTTTAAGT
ATAAGCAGCAGCTAATCGAAAACCTATTTATTGAAGCCTTTGCTGATACCACTGCTGCTGTCCACCTGAACGAGATGATGCCCAATATCTGCGTGGCTTT
CTCCATGTGAAGCCAATTCATGGTGACTGTTGACCTTCACTCCACGTCCTATTCACTTAAGTGTCACTTAATATAATACATTCAATTTGCCTCTTTGATA
TTATACTTCGAAGCAGGTTCCGATTTTACAAGAGTTGATTGTCTCTCTAATATTGTGGAAATATCGTCGATTCGAATTCGACGCGCGGACGCATTGGGCG
AGCAGGCGGTCGCTGCCGTTACATCCAAGCGCACAGTCCATCCCCAGCACTCACTATTCTCCAGCATGGCCGCGCGGGATCCATCGACCGAAGAGGACTT
CTCGTACCGGACCATGCCGGACGCCGACGAGCCATCGCATCCGCATCTGCGGCGCCGCGGTCCCTCGACCACGAGCTTCGTTGCGGACGTCACGCCTCCC
GCGACGCCCAGCGCTGTCGCCTCCATGCAGCCCGAGTTGAGCGCTGCGTTGGACGAGATGTCGGATGCGACCTCATTGCCGCCGCCACCAACCAAGGGCA
TTCCGTCGACGATGAAGGTCCTGAGCAACAGCTCGTCGGACGACTGGGCCGCGGAGGAGAAGACGCGGCAGGATGTGAAGGCGACACGCACCTCTGGAGC
CGAGCTGTTTCGGCGCAAAAGCACACACCCAGTGACCGTCCACCACCACCAACAGGAGCACCACATTGGGATCCAGGACACCAGCAAGAATGACGGCTCA
GTCGTCAGATTATCTCAAGATCGAAAGGTGCTGAGGGCGACCCAGCCGTCTGCGAATCTGCACGGGAAGGATCTGCGCAGGTTCCTGTCGATCGGATCCA
TTGAGCCGATCGCGAGGCACTCGAACTCCGTCGACTGGTCCGACACGATCGCGAGTGAGATAGAAGAGATGGACCACCTGTCGCTCATGGACCCGTACTA
CGACCTCACGCGGTCCAAGCTGACGAAGCTCTTCTCGCTCTTCCATCCAGACGGTACGTCCTTGAGGTATCTTAGTCTTAGGCCCTAATGCCTACTAATC
ATCTTCGTGTGGTTCATATGTAGCGAATGGCATGGTCAATTACGATGGATTCCGTCGCGGCATGGAGGCCATGGGGATCGTGTGCGCCAACGACGAGGAG
TTTGACATTTTCATCGAAAAAGTGGACGAAGACCACAGCGGCGGCATCTCGTTCGACGAGTTCCAGCACACGATCCAGGAAATCAAGCTCGCGCAGCTTT
TTAGCGAGAATTTCATTCGAGAAATGGGACTCGAGCCCTTGCCAAATGTGTCCCCCGCGATCGTTGGCGCCATCGAGTACTCTCCGGACCGCATTCGAAG
CGTGTACCCGGTTCAGAACATCGAGAAGTTCATTTACTCGAAGAAGCCCGCGTGGGCGACGGTGCGCTGGATCAACGTCGAGGTGTGCGACCCATTGATA
GTTCGCAGACTCTCGGTGCGCTACTGTCTGCATCCGTTGGCAGTGGAAGACGCGCTCGATATCGAACGCGAGCGGCCCAAGTACGAAAAGTACGAAGAGC
ATTCGTCGCTGATCCTTCAGACGGTTCACGCGATGGATCTCAATAAGCTCAAGTCGTACCAGCGCATGTATCGCACGTCGCTGTACACCAAGGACGATAT
GTCGTCAGCATTTGACAAAATGGACAAAAAGGAACTGACTGAGAGACTCAAGGATTTGCAAATCGGTCGTGTCATGACCAAGCCCGAGCAGTTGAGTGTG
TACATGCTCAAGGACGTGCTCATCAGTGTCCAGGAGACGACGAGTACGCTGTGGCCGATCGTGAAGTCGCGCTTGGATACCTCATACTCGAAGGTCCGTC
AGTACAGCACGCCGTTTCTCGTGTACACGATCGTGGATTCGTGCGTCGATGAACTCACGCCGATCGCGCATACGTTTGGGGCAAAACTCGTCATGCTCGA
TCGATTGCTGCACCTGGACCCTCGGTCTTTCGATGTCATTCAACTGCAAAACGCAGCCAAGCAGATCAAAGGCTTGAAGCGACTGTGCAGACCGTTGACC
GAGGTGATCGTGCAATTGTGCGAGTCGAATGATTTCACAGGCGAGATCCTCCGGTACTTTAGGGACGTCCAGGACCACATCACGATCGTCGACGAGGACT
GCGACAAGCACTTGGATACCTGCAAGAGCTTGATCGAGGAGCTCCACAATATCCGCGCCGCACAGCAGAGCGATGTGAGTTACATCCTGGCGCTGGTGGC
TGCAATTTTCCTGCCGGCGCAGTTCCTCACGGGGCTCTACGGTATGAACTTTGAAAACATGCCGGAGCTGAGATACCACTACGGCTACTACCTCTGGTGG
ACGGCTGTGGTCATAATCGCTCTGCTCACGTTTGCATTCTTCCGGTTCTACAAAAAGTGGATTTAGCTTGATAAAATGCAGAAATTCGTTGATATACATG
CATACGTGGAAGATAGCGAGCAAGCGACGGCACGAGTCTGGTATTCTCACTCACTCACCTTCAAAAAATCAAATTGATGGCGCTTCTGCTGCTGGTCCAA
AACACTTCAACGTGCTTGAGCAGTCGGGTGGCACCTGACGTACAACTATCCATCTTGCCGTGTCACACACAAAATCGCTCGTCCTTCTGAAGGATCTTCC
CAGTACACAAAGAAACTTTGATGTTTGGCAGCCCCTATCGTCCAATATGGGGTTGCCAAACATCAAACAAGTATTCCACGCCGCAGATGGATCTTTGTGC
GACCTGACGGTCGATCGTCAGGTCGACAGGTTGAATCGATAGCATGCGGGTACTTCGGACCCCCGGAAATTCAACCCGATGTGGCGGTGCGTCTCCCATG
TGGTACTCATTGTGTGGAGAAAGTTGTTTTCTTGTTCTGCATGTGTGATAGGAGTGGATGGGAGCGCTTCGCTTAGGTCCGCAGCTATCAGGAGTGATGA
TCTCTGACGACGGGGTAGGGCACGCACGTGCAACTTTGCTGCATTCGTCGGGTAACGCGATCAACTGTCTCTCTCTACCTATGTCATTGAACCCTCTTAA
TAGCGGCATTTGGGTCACTACAACAAAGAGAACGCTTATTTGAGTATGAGGAACATTCATCCATTGTCAGTAAAGCCAGGCTCATAGTACGTGTACAGAA
GGGGGTGCGTGTGTGCATAGCGTGGTCCAATTGTGACCACTGCGCAGTGTACACCCTGATCAAGCAACGTTTGGCGCCAAAAGTGGGTTTGCAACCCTCT
TTCATTGCGAAAACACGGTAGCTTCCGTGCTGTTTACTTCGGTGTCTGCGCTGCAAACAGTATCCATTTTGGTGGTGCTTTTCACCGCGTTTTGTCAATT
CCACGCTCCGCCTCCCTTTGCGTGTGCGTGTTGCACTCTCCCAAGAACGGTTCAAACAGACTGGTTTGGCCACTTTGTTGGCCGCAGCGGGGCTCATTCC
GCAATTTGCGCTCCAGCCGCCAAGTCACCCCCCCCCCCTCCACCAGCCGCTCCCCATGCGCGCCGCTCTCCGTCTCTCTCACCGCCTCGCCCGCCCGTCC
GCATTCTCGACTGGCCGTCGCCTGCGCTCCACGGTGGCAGCGCCAGCCTCGCTCGCCGCATCCTGGGACCGACCCTTCCCATCGCTCTTGGTACGCGAAT
GCTGCATTTTTTTTTCTTCTACTGTAACTAACATTGCGTTGGGCGTGGATGCGACAAATAGATCTCGGAGGACCATGTATCGGCGCAAGGTTCGTTTGCC
GAAGCGCAAGCCAACTACTTGCAACCAGACATGCAAGTCGTAAAGGAACTAGACGCACTCTTGCACGAAAAGAAAATGGGCATTGTCGCTCATTTCTACA
TGGACCCGGAATTGCAAGGCATCTTGTCGTCCTTGAAGTGGGAGCACACGTTTATCGCCGACTCGCTCGCCATGGGTGAAGCTGCTGCCAAGATGGCAAA
GAAGGGCATCCAGTCCGTTGCCGTGCTTGGTGTCGATTTCATGTCGGAAAGCGTGCGCGCCAATTTGGACTCGAACGGCTTTGAACATATCCCAGTGTAC
CGTCTCGCCGAGCAGAAGATTGGATGCAGTTTGGCCGAATCCGCCGAGAGACAAGCGTACATTGCGTACCTGCAAAAAGCGTCGAAGACTCCAAACAGTT
TGCACATTGTGTACATCAACACATCGTTGAGAAGCAAAGCGTACGCGCATGATTTGGTGCCAACGATCACGTGCACGTCGTCGAATGTCGTGCAAACCGT
GTTGCAAGCGTTTGCGCAGGTGCCAGATATCACGATCTGGTACGGTCCAGATACGTACATGGGTGAAAATCTGGAGCAAATGTTCCAGCAAATTGGCCAG
CTTCCGGACGAAAAGATCCGCCAAATTCACCCTCAGCACAACCAAAAAACGTAAGCTGGGTTTTCATTGTTGGCATTGCACCGTGATGAAAATGTGTCGG
GGCTGACTTTTCTTTTGTACATTACAGGATTGCGCAATTGTTGACGCGCTTCGAGTACTTTAAGGAAGGCAACTGCGTTGTGCATCACATGTTTGGCGAC
AAGGTCACGAACCGCGTCCGTGAGGAGTACTCGGACGCCTTCCACACTGCCCACTTTGAGGTACCTGGTGAAATGTTCACACTCGCTATGGAAGCCCAGA
ACGAGGCCCGTGGTGTCGTTGGCTCAACGTCCAACATCTTGAATTTCATTAAGGATAAAACGCGTGAAGCCGTGAAGAAGGAGTCGACCGAAAAGCTCAG
CTTTGTGCTCGGCACAGAAGTCGGTATGGTCACTGCAATCGTGCGTGGCGTCCAAGATACGTTGCGCTCGCAACCTGGCTCCAAGAAACCGGAAATTGAG
ATCATTTTCCCAGTGTCTGCCGACGCCGTCGCAACTGAAGGTGAAGAGCTCGTGCCTGGCGTTGCTGGTGGAGAAGGCTGCTCGACTGCGGGTGGCTGTG
CAACGTGCCCATTTATGAAGATGAACGACATTGACGCGCTTTTCAATGTTGTCGAAGGCGTCTCGGCCGACGCCAGAGCCGTGGATCCTTTGGCTAACTT
TTACCCGCAGAAGTACAGCGAACTCATCGCGGGCAAGACGATCTCCGATATTGGCGTGCAGCCGATTTTGCACATGAAGGCGTTCATGGAAGGCGGTAAG
CTCTCGGACGCTTTGGTGAAGGATATTCAGACGCGGACACCAGGTGCGGGGTGTCCAGAAGCCAAACACTAGGTGAAGGAACGATACGATATAGAGAGGT
ACAAATGTGAGTGATTTTTTTTACTATATATAATTTGTTGCGCATACTGGGGTTCTCCTGCTTGTATGTTCTATTCTTGATGAAGCGAGGAGCGGCCGTT
TCTCACGGATCACTTGCCACAGCTTCCGTTACGCTTGCGCCGTGAAGTTATCTCCAGCGGTTCCGCCGCAGGCGATCGATTCGCTCAATTTACGCGCGCC
GTCTCGCCTCAACTGGCCGGCACAAAGCACGCACAGGCAGGATGGAGGACGAAAAGGCGTCGGCCGATAGCAAGGGAACCGCGGAGCAGACTGCGCCGTC
GACCGGGTAGGAACTGCATTCATGTGTCTGTCTGCTCTCTTCTCTTTCCTCACGCTCCTGTTTCTAATACTTTAGACCCCCTCGTGTGAAAGCACCGCCC
AAGACAAGTCCTCCGGATGCCAAGGCGGGTGATGAAAAGGTATATCCATGGACAAAGTTTGGAGCTGTCCACTTCTCCAGCTTGCTATACTCGGAAACTA
ACGTAGGAAAATGCACTTGATGGCCAGGATGGCGAGGAGAAAAAGAAGCCAAAGAAGGCGTTGCCACCGCCCTCCAATCCTCCTCCACAGGGCACAAACT
CGAATGCAGCGGCGGCCTTTCGAGTGAAATCGTCCTTGCCTCCACCGAGTGGACCGCCTCCGAATGGAGGTGTAGCATCGAGTGCGTCCGTAGCAAAGAT
TCGCGGTTCTGCACGACCACCGTCTGCTAGCCCTCCACCATCCGGAGCAGCACTCGCAAAACCAGTGGGAGCGCCCCCGAGTACAAAGCCACCTCCGACG
AAAGCCCCACCAAGTTCAACTCCACCACCAAGAGCTGAAGCCAAGCCAAGTGTTGTTGAGGATGGAGCCAAGCCCAGCGAATCAAAGGTTGGCGCACCAC
CAACAATGTCGAGGGAGAAGGCGGCACCAGCGACATCACGAGCATCCGAAGCCGGAGGAGAGACCAAGTCGAAGCGGCCATCTACTTCGGGTGGAGGGGC
CAAGCAGGTAGCGGCACTTCCTGTCGATATCCTCGGAGACAGCTCTCCCATCCCCACCAGCAATAGCGCTCCAGTGGCTGAACTCAGCGTACCGTTATCC
ACCAAAGTGCCTCCGAAGCCAGTGCCAAAGCCGCAGGTTTCGCAGCCGCAACAGCAATCGATGCTGACGCGACCGAGCACATCTACAGGGCCAATGGGCT
CAGATGCTGCTTCGTTTAAGCCGACGATTGTCAAAAAAAGCACCATGGAGGTGCTGAATGATACGAACGCGGCGCTTTCGTCTCGAAACCGCAACATTGA
TGAACATTTGGCCAATACCGCGCCGAGTGCCGCTGCTGCTAGTAGCACCGGTGGACATGAGGACAAAGTGACACTGAAACCCACTCGCGCTGTGCCATTC
AGCGGTTCGTCGCGTCCAAACGTCCCTGACGAAGAAGTGATCCTCGTCAAGAAGCAGGAACCCAAGAAAGTGGAAAGTGCAGATAATGGCGACTCGGGAA
CTGAAAGTAAGGCCATGGGTGCAAAACCTGCATCTACGTTGAATCATCACCATAACTTTGACGACTCGCTGGACGACGTGGAAGAGATTCCGTTTCTCGA
GGAAGCAAAACCCGAGCCAAAGCAGCACCTCGACGCGAAGAAAACACCTGCAAGTCATGGTAATGAAGATGATCCGATCATCGAAATTGAGAGTAAGCAC
GCAGCGCCTAAACCCAGCACTTCAAGGGGTCTGGGTACAGGTAGCAATAGCTCGTCTCTGCCGCACCAACAGAGCGACTCAAAAGAACACAAACCAGGTA
GTAACAACAACAAGGATGAAGACGATGACGAGAACTTGCTCACGAATCGAAGAAAAGAGAACAGCCAAGAGGACATTTATGACGAGCTTCGGAAACTCAA
GCGATTGTCGCCGCGACTCGACGACGAAACGAGTGAATCGTCACCCCGTGATGCCAGCGTCAATTTGTCGTCTCATAGCACGCGGCACGAAAGCCACGAT
GACGACGGCGCAAAAGACACGAGCAGCAACAGCGGCCATCGCGACCGATCACGGGAGAAACGCAAGGATAGGCGACGAAGCAAGCATGAAGACGAGACCA
AGAAGATTCAAGCCCAGGTACGCGTTGCTCTTGATGCTAATAGTCATGTGCCTACTTATCGACGATTTTGCTCTCGTACTATTGTGTCGTCTCCAGTTTT
TTAATCCCAAAAGCGTGCCGTACGTGCCCGATCACTTGTTGGATTTTGTTAAGCGGCCGCTCGAGTGCGGTCGCGGCTTCATCATGAAGTGTTTCATCGA
GCGCAATGACAGTGGACCAAATAAGTTGTCGCCGATCTACACGCTGCTACTCGAAGTGAATAGCTCCAGCGGACGTCCGATCATGTACGCGCGCAAGAAA
GCGGCAAGCCGAATCACGTCCCACTACGTCATATCCATGAACAAGTACGTATTGTGACTGTTGCAACAGGACGAAATGTCTCGAGTATCACTGACCATTT
GTATTGACTACTACCCAGGGACGACCTGTTTCTTTCGCGCATGATGCGCAGCCACCAGTACATTGGCAAGTTGCGGTCATCGACAAGCATGATGGAGTAC
TGCCTGTACGACCAGGGGGACAACCCCGAGGACCTTGATTCGGACTGCGAGGTCGACGACGAATTGCGAAAGAGCATCCGCGCGGAACTCGCCGTCATTC
GTTTTCACAACTCGAAAAAGGTACGAAGACACATATTCGAGTTTTCACTCTCGTGTTGTCTCATATTCAAGCATCGCTGTTCTGTTCTTGTGGCACATAG
CAACAATATGCGCGCAAGATGGAGGTCGTGATCCCGTCGATCGTGGAGAACGGCACGTCGTACCTGGACTGGCGTCCCATTTCGCGGGATCAAATGATGG
AAGAGCATGTCCGTGCGATTTGTGCTGCAGTACGTTATGCAAATGAAAATGAACCTACGCGTCGTGTTTCTGAAATATAGAGAAAAAAATAAATCGACTC
ACATGTATGCATACCACAGGGCGGCCAAAACGTGCTGGACATGTCCAACTTTGTGTTTATGCACAAGCGCGAGACCAAGTACGACCCGCTGTCTTCGTGC
ATCGTGGACTTTCGGAGCCGCGCAACGTGCGTGTCAGTGAAGAACTTCCAGCTGGTGCACTCGGAGCCCACGAACGAGCAGATGAAGGACAAGTACAAGA
AGCTGCATCCGGAGTTCGTGTACGAGGACCAGGGCACCGTGTCGCTCCCGCAGGAGCACGTGCTGCTGCAGCTCGGCAAGGTGGGCAAGGATTGCTTCAA
CATGGACTTCCAGTACCCGCTGTCCATGCTTCAGGCCTTCGCCATTTGCCTCAGTCGCTTCGACACCAAGCAGCGGTGAATGGCATCCGCGACGGCTTGA
TCGATAGCTACCAAACTGAAGCCAAAAGTGTACCCATTTATCAATTAAGAGAGATGGATCGTTTTCCAGAATCCGATGTTCATTCAATATCAAATTAAGC
ATTCTATAAACTAAAAACAAGGGGGTTTTGTTGCAACAGGTGTTTGCGGAATGATTGCGCAACAAAACATGATGGGCAGCCTACCAAACAGAATACGTAG
CGTTATTGAGCATACAATTGGTGATGCGTCTCATACTGTCAACGCTTTGAAAATACCTATCAAACAGACTAGTTCAATCAGACCACGTCTCGTCTTGCAG
AGCTTTCTGTGCACGACGATCTCCGATGCGTCCCGTCCGAGTCAGGTATGTAGCGCGCTGTTGATGAGTGTAGACGCGCGCGGAGGCAGACCACTGCGCC
TGTGGTGTCCTCATTCTCCAGTTGGCCGCGTCGCGCGCAAGTCCCTATCGCGCTCTCCGTTCCTCCAGCTCCAGATCGCGCGCATGACGGTGCAAGAGAA
GTCACCGCTGCTCAAGCCCGAGCCGTCCAAGGCACGCGGCAAGGAGCCCGATGTGGACATCCGCGCCGAGTTCCTCTCACTCACGTCCATGGCACTGCAG
GTGAGTCTGTCGACGTTCGCTCGCCTCGCGCTCACGTCCGTCGACTACGCGTTCCTCGGCCACCTGGGCACGAAGGAGCTCGCGGCCGCGTCGCTCTCGT
CGGTCTGGACGAGTGTGCCGCTCATGGGCGTCTGGGCCGGTGCCGGCGCGCTGACCACGCTCTGCGGCCAGGCGTGGGGCGCCAAGAACTATGAGCTCAC
GGGCGTGTGGCTGCAGATGGGCACCGTCGTGTGCTCGATCTTCGTCATCCCCGTGTTTATCTGGTACTGGTGTGTCGAGTACGCGCTGGCGCTGTCGACG
GACGACCCGGAGGTGATCCACCTCGGCGGTCGCTTCGCGCGCATCATCTCTTTTGCGTCCTGGCCGGCGGTCGTGTACGCGTGCGTGCGGTTGTACTTTC
AGTCCATGGGCATCATGGCGCCCACGACAGTTGTCGGCGCGCTCTCGATCGGCGTCGCGGTCATGGCCAACTATTTCCTGATCTACGGCTGCTTTGGATG
GGGCGGCCTCGGTTTCGACGGCTCACCGCTCGCGACCGTCATCGCGTCGTGGTTCCAGCCGATTGCGCTCGTGTCGTACTGCGTCTTGTATAAGAAGATG
CACCTGCGAGCGTGGGGCGGGTGGGATCTCACTGCGTTTACACCCGACCGACTCAAGACGTATGCCAACATCGCCGGCTTCATCGCTGCGAATAGCATGA
TCTCGAATTTAGCGAGTTCATCGTTGTCGCTGATTGCTGCGAAGCTTGGCTCCGATATCATTGCCGCCAATGCCGTGATCACTGGCCTGTGGCGATTGCT
GTGGGCGCTGTTCTGGGGCTTTGGCTGTGCGACGCAGATCCGTGTCGCCAACTGTCTTGGCGCGAATCGTCCCCGCGCTGCGAAGGCACTCGCGAAGCTC
GGCTTTGGCTGCACGATCGCGTGCGTGGCGGTGCTGGCGACGATTACGCTCTCGCTGCGCGAGAAGCTCTTCCAGCTGTACACGACCGACGACGACCTGT
TGCGCTTGTGCATGCTGGTGCAGCCGATCTTCATCACCGGGTACATGATCGAGTCGATTGAAATGCTGACGTCGGGCGTGCTGACTGCGATGGGTCGCGT
GCGCATCATCGCGTGGACGAGTACGTTCTCAACGTGGTGCATCGAATTGCCCATGGCGTACATTGGCGGCATCGTGCTCGGCTTTGGGTTCCCGGCGCTG
TGGTACTCGATTTGCACGATGGAAGTCGTGAAGCTGATCGTGTACCTGATCACGCTGTCGCGTACCGATTGGAATGAAATGGCGCGAACCGCCGTGGAGA
ACATGGAAGTCACGGACGAGACCACGGGCGAGCTCGAGGACGAGGCGTTTAGCTTTGCGCTCTCGGAAGGCGGCAATGCGCCGTTGGGCTACAACACCGT
GCCGCTCTCGCCTTTGACCCCAATCCCGACGCCGTCGAGCATCTCGTCCAAGCAGTGGGGGGACGACGTGGAGGACGGGAACGGCCTCCACATTCGTCGA
TCCCGACGCACGGGGTCCACAAGCGGACTGTAACGAGAACAAGATGATAGGACAGTTTCTACAATTGCGTGACGATACAGCGAGGTATCCAATATATGTG
TGAGCTATTACTGACGCGCATCCCATTTCCATATCCACGAGGGCCTGCTCTGCACAGCTGAAGCGACTGGGGCTGTGACACGAATCAATTCATGGCGGCG
CGGGGTCCCGGTCATGCACTAGCAGCTGAAGCCATCGCGTAGCCAGTCAGTCAATCAGGTGGACGGTGCATGCGCAGTCTGTCTCAGTCATTATGCTTAA
TTATATTAGCGAGTCTATCACTACTGAGAGGTTGTTCTTATGGGTTGAATTCAATGCTCTGAAGAGCGAGACCATTAAACTATCGTGGTATACAAGTAAT
AATGGGAGCTCTACACTGCTTTTTCTCTGTGCGCTGAGAAACATTACTTTAGAGAGACCATCTGATTCCGCGTTCGTAAAACCTGCAGCAATCGATACTC
GAGACAAATAGAACGTGCACGGTCACAGTCGATTACCTGTATAAATACATACTACCTAAACAATCAACACAACGCCCACAAGAGTGATGATCATCGTTAT
AAATCGCTGACAATGATGCGCAATACGTGGTGGTGGTCACACGCGACGAGCAGCTCTCGTCCCCAATTCGCAGCGCGCAGTTGGTCCCGTCCACCCACGC
GCAGCCAGCAGCTACAGGTCCATCTCTCCTCTCTCTCTCTCTCTCTCTTGTTCCGCCTCCTGCCACTCAGCTGTGCTTCGTGCGCGCTCACCGCCGCATT
CCATTCCCAGAAGCTCATTTCCGTAAACGAACACCAGCGAGCAAGCCCAAGCCCACTTTGTACACGTAGTACGGAATGGCGGGACAGGAGAAGTCACCGC
TGCTCTTGGGCAAGAAGCAGGACGGCGATCGCTCCGCGCTGCTCAACAAGAAGACGCAAGAGCCGGAGGTCGACATCAAGCACGAGTTCCTCTCACTCAC
GTCCATGGCGTTCCAAGTAAGTCTCTCGACCTTTGCGCGTATCGCGCTCACGTCGATCGATGGCGCGTTCTTGGGCCACTTGGGCACGAACGCGCTCGCC
GCGTCGTCGCTGGCATCGATCTGGACGAGTGTGCCGCTCACGGGTGTCTGGGCTGGTGCCTCGGCGCTCATCACGCTGTGCGGCCAAGCATGGGGCGCCA
AGAACGGCAACCTCGCGGGGATCTGGCTGCAAATGGGTCTCGTCATCACGAGCATCCTGATGGTTCCTGTGTTCATCTGGTACTGGTGCGTTGGCATTGC
GCTCGAAAGCTCGACAGAGGACACTGAAGTCGTGGCGCTGGGCGTGCGTTTCGCCCGTATCCTGTCGTTCTCCATCTGGCCGTCGCTGATATACGCGTGC
GTGCGATTGTACTTCCAGTCTATGGGCGTCATGGCGCCTACGACGGTTGTCGGCGCGCTCTCGATTGGTGTGGCGGTTGTTGCCAACTACTATTTCATCT
ACGGCGGCTTCGGATGGAGCGGCTTGGGCTTCGATGGCTCTCCGCTCGCGACGGTCGTTGCGTCGTGGTTCCAGCCGATTGCGCTCATCTCGTATTGCAT
CGTGTACAAGAAGATGCACCTGCAAGCGTGGGGCGGCTGGGACTGGAACGCGTTCACGCCTGAGCGCATCACAACCTTCCTCAGCATCGCTGGTCCAATC
GCCAGCAACAGTCTCGTGTCGAGTCTCGCGAACTCAGCGCTGTCGCTTGTCGCCGCCAAGCTCGGATCGGACATCATCGCTGCGAATGCCGTCATCTCGG
GCCTGTGGGGGTTGCTCTGGGCGCTTTTCTGGGGCTTTGGCTGCGCCACGCAGATCCGCGTTGCCAACTACTTGGGTGCCAACCGTCCTCAGGCCGCCAA
GACGCTGGGCATGCTCGGCTTTGTGTGCACGATCGTCACGGTGATCACGCTCGCGACGCTCACGCTGAGCTTCCACGAAGCCATTTTCCGTGTATACACG
AGCGACGATGACTTGCTCAAGCTCTGCATGCTCGTGCAGCCGATCTTCGTGTGCGCGTACATGATCGAGTCGATCGAGATGCTCACGTCATCAATCCTGA
CGGCTATGGGCCAAGTCAAGGTCACGGCCTGGACGAGCTCGCTCTCCGTGTGGTTCATCGAATTGCCGTTTGCGTACATCGGCGGCGTCGTGCTTGGGTA
CGGCTTCAAGGCGCTCTGGTATGGTATTTGCGTGATGGAGGTCATCAAGTTCTGCGTGTTCGTGTTCACGCTCTCGCGCACCGACTGGCAGGAGATGGCG
CGCATCGCCGTGGACACCATGGAGGCGAACCCGGAGGACGAAGAGGAGCAGGAGGCCGAGTCGATCCAGTTTGCCGTGGCCGAGGGCGGCAACACGCCGG
TTGGGTACAACCCCATGACGCGCTCGCCCGCGATGGCACTGCTGACGCCCGTGAGCCGACAGAAGCAGTGGGACCAGGTCGAGGGCGGCGCCCGCCAGCG
CGGCTCGTTCGCGAGCCCCAAGCGCGCGAGCTCGTTCTCGCACGCGTAAATATGAACACGAGAGATAGAGAGGGCGAGCGCGCGTTCCAGCAGGTATAAA
AGCGTTCCAGCAGGTATAAAAGTTTTGAAAATGTTTCTAGTTTTGTTTGATATACACACACATATGAACCCACTGCTGGCAAACGGTGCACTGTTTTGTT
TGTTTTCTGGTTGGTTGTTGTTGTATTATTAATCAGCTACACTACGTTTTCGCCTTATACGTCGCCATCGTTGTTGCTCGGACTGTCGAGCGCTTCCATC
TCGGGCACGCGGCAGCACGGGCAGTGGCCTGCCTTGAGGTACTCGAACTCAAAGTCTTCCTCGTGGAAAAAGCGGCGGCAGTGCGGCGACAAGTGGATCT
TGATCTCCGGAATCATGTTCTTAAAGTACTTGTGGCGCACGAGCGGCGACGGGTACTTGACGATGAACACGTCGCTCGGGTTGAGACTCAGCAACACGCG
CTCGTCGACTTGGAGCACGCGATACTGCGCTGCTGACGAACGGTGGCCCGTGTTGGGGCCGTACGAGGCCTGACGGTTGAGCGCCATGTCAAAGAGATCG
CCTTTAGGCCCGTTCCCACCGGTACGGCGGCCGTTGTTGTCGTCGTCGTCGCCAAACTTCATGGTCTGCGTGCCGTCACCGTGGTCGGTCTCCTTCCAGC
CGCCATCGTGCTTGCTGTTGCCGGATTTACCGCCCGCGGCGTCGTTTGGATGCGTCAGAATGAGCTTCTCGGCTTCTTCGTCCGAGAGTCCAGGCTACAT
GCACGGCATTCAAGACCAAGAGCAATGTGAGCATGGAGACATTGTCAAGGTGATGCATTGGTTGATAGACGTACCGTGGGCTGGAACTCGACCAGTGGGA
GGTTCTCAAACGAGACGAAGGAGCGCACAAACGGATGGCCCGAGTTGACGCACACGTCGCCGGTGCAATTCGGATTCAACAGCGGATTTGTGGTCGACGA
CCGGTAATCCACCGGCAGCAGCTCGTCCTTGTCCGAGTACGGCTTGGTCTGCAGCGTCATGGACGTGAGGTCGATCTGTTTCTGCCACTCGGGCCGTAGT
TTCATCTGCAGCAGCTTCTCGAACGCCTGGCGCGCCAGTTTGTACGTCTCGAGCTGCAGCGCGTGGTGGCCGAGCGTGAAGTAGATGTTGCCCATGGACA
CACCCGGGGGCACCTTGCAGCCTGTCTTGCTGATCTTGTTGATCAGAAACCGCGCTGAGTGGAACAGCGACTCCGGAAGCAGCGTCGTGAACGGCTCGTC
CGTGTACGAGTAGATCATCGCGTACGCGTAGTAAATCTCGGAGAGGTACTCGTTCTCCAGTGCGGCTGTAACCTGGGCTTGCTCGGCCTCGGACGGACCC
TCGGGGTCACTCGGTTTGATCGCACTGAGCTGCTGCTCGCAGAGCCGCCAGTGGTAATGCGACGCGTCTCGGTACCGCTTCTCGGCCACAGCGTTGTCGA
TCAACTGCAGCAACAGTTTCGAGCAATGATCGGGACGTTTGGCTTTGGCGTACGCCTCGAGCGCGTCGTCGAACCGGTCTTGGCTCGTGAGCCACTCGGC
GTACGGCACGTACACGTCCTCAACGTTCTTCACGCGGTCCTCGTGTTTCTGCACGAGCCGCACAGCTTCTTCCCATTCATGCAACCGGATGTGCATCTTG
AGTAGCGAGTCCATGTCGCTGATCTTCAAAAACACGTTGCGCGCGTGTTTGAACTTTTCGGCCTGGAGGAAGTAGTTGGCGCACAGCGACAGGATCTTGG
TCTCGCCGACGTCGACCTTTTGCGCGATGTCGAGCAAATCGTCGTACCAGCCTCGCTCACCCATGATCTCGACCGCCTTGAGCGTGTTGCCGCTCGCGGT
GTACATCTCGGCCGCGGCGCGCCAGTCCTGCACTTCTTCGGCCCACTTCGCCTGGTCCTGCACGAGCTGCTTGATGTCCACGATCTTGCTCTGCGCAGCA
AACTTCTTGGCGTCATCCCACATGCGCAGATCCGCAAACATCTTGATCGCGGTCTCCGCTTCGCCGCAGTCCGTAAACAGCTTGGCTGCGAGCTGGAACT
TGCACTGGTATGCCATGATCTCGGCCTGCAGCATCGACTTGACTTTCTTCGCGACCTCGGGGTCCGCGGTTTCTTCGTTCGGCAACTGGAGCTTCTTGCG
CTGCTCCAGCGCGTTCACGAGCTCAATGTACCGCACGTCGCGCACGCGGATGAATGCCTTGCGCGCGATCTCAAAGTTCATGCTCTTGAGTGCTTCCCAC
GCGAGCAAGCGCCAGTCGGCCTCCGTCACACCGAGACAGGACACCTGGTACGCCTTGGTGAACTCGTTTTGCTCGAGATACCGATACAGCGGCGCCGATT
GCGGCACGTCGATCGTCTGCACCGAGAGCGAGTTGAGGCAGAAGACTTTGGAGCCCGTGAAGCCGACGACGAAGCCCTGCATCCGCTGTGTGTGGCCCGG
AAAGTTGCCCGTTTTGATCTTGAGCTGCCCGTTGCCCGCAAAGCAGAGCATGTCTTCGAACTCGGTGTTCCACGCGACGCTGTTAGCGTCCCTCTCCTCA
AAGAGCATCGCTTTCGTCGCGAGGTCGTACACAATGCACTTGTGCGAATCGTCCACCACGGCCAGTTTCTCACGGCTGTAGACAAGCACGTACACAAAAA
GAGTCGACATGCCCATAGATGGACATCAAATTAGCAGCTGTCGCCACAAGGGGGACACAAGAAGGACACAAGACAGAGGACGTACTTGGAGCTGATGTCG
AGACACGAAATCGGATTGTTCTGGCGGATCAACGGGATCGGGAACGGGTTGTTGATGAAGATTTGCCACACCGAGCCGTCTTTGAGCCCCACGAGCAGTC
CTTCCTTGCCTTTGGCGCCGCCCGTGACTTTGATGTACCGGATGAGCGACTCCATGACCCACTCGCGCTCTTTTTTGCCCGAGAAATCGTACTGCTGGAG
CTTTTGCTTTTGACACAAGATGAAATTGTAGCTCGTGACGACTAGTAAGCTGCACGGAAGATCCTTGATGATCCGATCTTTGACGCGGTACCGCATCTCG
TAGCTGCTCACGGCGCCGCCGGACTCGGATTCGAGCTCGTAGATAATGATCTTGTCCGAGAGCTGCACTGCCAGGCGGTCGCGGTACACACTCAGCTTCT
TGACGCAATCGCGCGTGCGGATGCGCACTTTCTGTTCTGTCATGAGGTGCTGTACGATCACGTCCGTAATGTTCTCGCGGTACGCGTACCGTTCCTGGTA
GATGCCGTGCACGGTGCCAAACACCAGGCAGTACACGGAAATCGATCCGTCCTCGCACCCGACGGCGACGAAATTCGTTTTTGGCCGCGCCCTGATCGCC
CAGACCCAGTTCTCCAAGTCGGCAATGCTGCGTACAACAAACTCAAGTGAGAAGTGCTGCAAGCGTCCAGTCAGTGTAGGAACCACCATGGGACTTACTT
TGACAGGAAGATGCCGTCTTTCGTATACAAACCCGCTTTTCGGTTGGAACCGCCGACGAGCAGGTATTTGCCCTTGCTACAGCCATCCACAAAGCACAAG
GCATGCACACAATCATGGATATCCGCTCACTCACTCAGCAGACAATGACGCAAAGAATAGTACCTGAAGTATGTGATGCTTGTCGGGTTGAATGCCAGTG
GGCGAGGTTTGCCCAGTGACACGCCGCTGAGGTTGTAGAACGAAAGCGTGCGGTCCCAGCACCCGACAGCCAGGACATCGACGTTGTCTTCCTGGGAGAT
GCTCCACGCCAGTGTCCAGACAGGGCCGGGGCGTTCAATCAGCTGCTTCTCATTGCCCTGCTTGTCGCGCACCGTAATGAGACCATTGAGCAGTCCAAGC
GCCAGATACTGCCCATCTTTTGTCCAGCACGCGCTCAGGACTTTGGCGACGACTTTGTGCTTCGAGACTGATTTCTGCTCGGGTGCCCAGAGCCCAAAGT
CCGAGATCGTGCAACTCGCGAGGCACTGGGATTGCGGGTTGTACACCAGTTTCTGGATACTGTCGTTGTGCGTGTACTTGAGGATGCCCTCGGCCTTGTC
GGTCCAGATGATCACGACGTTGTCGGCGCCGCCGGACGCGAACCGCTTGCCGTCGTGCGAGTAGTCGACTGTGTACACGATGCCCTTGTGGCCTTTGAGC
GAGTGCAGCAACGTACCGTCGATCGCGTCGTACACCATCACGCGCGTGCCAATCGCGGCCACGAGCTGCGTGCCATCAGGGCGGAACGCGATATCCTGCA
CGATGAACTTTTCGCCATTGCGCTCGGGGACCTTGTCGCTCCACGCCAACACGCTGCGCATGGCGGCCGAGAGTGGAAGGGGGAGGCTTGGGGGGGGCGA
GCTGCTCTCTTGTGGAATCGTGTGGCAAGATGCTGTCAACGCACACACGAGCGCAGAGTGCCTCGTGACCCCATAAAGATCGCGAAAAGTCGCGTGTGGC
ACTGGAGGACCCGAAACGACGCGGACAAAGAAGATCATGTAGCGTGTACATGGAAAGGGCAAATGGGCCTCTCGTCTGTGGAACTCTTCGTTCTCAGTCA
GTGTGATGCCTGGCATTGTGTTTGCCTTGTTACTTATTGAAAACACGAGAGTGCGAGTGACGATGACGAGAGGAGTCGAACCGCAGCTGTAGCTCGGCCA
CGTTAGTGACAACGCCCTGCGACTGCAAAAGAATACAACGATGGCGACGGCTCCAGTTGCGGTGGCGCCATCCTTTGCCGCGCAGTCGCGAATCCGCGTC
GTCGTGCGTGTGCGGCCGAAACTTGCGATTGAGAAGAACGATTCGAGTGAGTTCCTCACCATTCACCGGTCCAGGTTTGTGAAAATGCTACAAGCCCCAA
CTTTTGTGTGAGAGAAAGCTGCTTGATGAATCACAACGTTTTGGTATCGTAGGAATGCTCTACAATTGTCTGCATCGACGTCGACGACCGATGCGAAACA
CTTTGTTTTTGATCAGGTGTTTGACCCCGTGACGACTCAGGTAGAGAGCAACTTGATCTTTTGTGCCTTTAGCACCATTAGGTTGAGCTGGAAGCCATTT
GTGTTTAACCTCACACTTCTACTAGAGTGAACTGTACGACCAAATCGGACTCGCGAGCATGCTCTCTGGCGTCCTCGAAGGTTATCATGCGACCATTTTT
GCGTACGGACAGGTGCGATAGATGTGGTCTGTCTCGGCAATAGACTCGTAGGCGACAAAGAACCTACACAGCTTGACCGATTCACATGGTTTGTTGTCTG
CTTGGGATCCTAAAAACACGACAGACTGGCTCAGGAAAAACGTTCACGATGGAAGGTTACGAATATGAGGTAAGCCTCCTCGTGCTGCGTACTTCAGCTT
TTTTTCGTTTAGTGTTACCATTTTACTCTTTGCCACAGCGTACACGCGATATCGCCTCGAGCCATGGAGACGAACGCACGACCTCGAAGCCCAAGGTCGA
CGTGAATCCCACATCAAATCGCATTGGGGTACGCTCGCAATCGCGAACGATTCTACCTTTTCAGCAGGAATCTCTGAGGCCGTGTCTAATTGCAGTATGT
TCTACCGTGGCCTCGGATTCAACTTAGATCATCCCACGCGTGATCTTCAACCTGTTTGAGATTATCTCGGTTCAGTCGCTCGCATCGTCGACCACGCGGC
GCGAGTTCACAATCAAGTGCTCGTTTGTGCAGATCTACAACGAACAAATCCTGGATTTGTTCAACCCTTCGCATCT