Description :
From Genome Similarity Track
Location :
Scaffold_32:153501- 155685
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G010768Protein of unknown function

Sequence
2184 bases(100 bases per row)
AGATCTCGGCGACGACCACGCTCAGGATGCCGCCAAAGGCTGCGAGTCCCAACAGGAACACGTAGACGTTGACGGCGTTCGTGCGCTCGGCCTCGCCCAG
CGTCGCGTCGTCGCGCTGGATGCGCAGGTCGTACTCGCGGATGTAGTTGACGAACGCCAGCGCGAACAGCGCGAGCGACGTGAGCACCCAGCCGAGGACC
ATGTACGACTTACGGTGGCATCCAAAGATTGGGAACACGTCCGAGCAGAAGCCCGTGATGAAGCTACACGCCCAGGGCAGCGTTAGCAAGATCTGCGCGG
CGTCGAGCTGCGCTTGCTGCAGCTTCAGCTCGGCTTTCATCACCGGCAGCAGGCCACGCTTCAGCATCGACGTCAGCAGACTCGCAAACATGAGCGACAT
GAGCAATCCGATGTGCTCGGCGCTAAAGAGCGTGGCTTTGTGCGTCTTTCCCCTGCGTCGCGACCTGTGACGCTCACATCGCGCATCGTCATCGTTGGCG
ACGTGGAGAACGGATACCTTGGCAGGGCTCAGTTCGATATGGATGCCCTCGCCAAACACGTCGCCCGCCGTCTTCGCTGCCGTCGTGCTTTTCACGTGGT
AATGCGCCGTCGCGCTGCTCGCAGGCGTGATGCCGAGTTGCGACTGAGCTCCATGCTCCGACTGGTATGGTGAATCTCGGGGACCGGCAAGGGCGGCTCT
GTCTTCAGCCAGGGAAGCCTCGGTCGCCATGCTGCTTCCGTTGTCGCTCTCCTGTCCGCTTGTTCGTTGACTCCGCCTGACCTGCTGATTGGCGAATGAG
CGGCTCAAGAAAGGCGATACGTCCCACCCGCCTTCCTCCCTTCTGCTGCTGCTGCCCGTGTTGCTACGTGGTAGGATAGACGGGGGCGTGGGTGCGCGTG
ATGCGCTTGCTGCGGATGTGTGTCAGCATCTTTAGAGTGGTTTATCGCCGTCAAGCGTTGAAATCGTGCACTTGGGATTTGCGCCATGCGGTCCGACAGC
ATGTTGCTTGCCTGCAGCGATCAAGGTGTGTCACGAAAACAATCTACCAGTAGATACCGGTACCTGATCCGAACTGATACTGGTAGTACTATTGCGTCTA
TCCGCTTAAAAGAGCCGTGACTTAATCCGGATGGTGACTTTAACAGTCACACGCTCACCACGTCAAAAGTGTTCATCACTTTCACCAAGTAAACACGACC
GACCGACCCGTCGTCCGTAATCGAGTGACTTGACTTGACACATCCGGATGCCGATCTCAGTCGGTTCGCTTATTCTAGCTAATGGTGAGCGGTGGATGTC
GCAAAAATAAATGAGCAGCATGCGCACGTGCCGTGATCATGTATTCCTCATTTTAGCGCCGTGAAGAATTCATTCGCACATGCACTAAGGTACGCAAGGT
TTGCTATATAAAGGAGGCGCTTTATGTATCAACACCGCGTAATCGTCAAAGGCAAGCAAGCCGTTTGTGTGCATGCAAGTGACGCAAGAGAGGCGGGCAC
GCGCAGGATCGAGGCGACTCGCGCATTTCCACTCTATGGTTGTTCCCTTGACGCGGTCATTACCGACCGTAGATGCCGTGTCCGCACAACGCAAAGCGGA
GTTCTGCGCATGCCGTTGTCACGCGCACAATGCAACGCCGGTTCTTCCCACGTTGCGGTCCTGCTCATTATTGTCGTCGCCTAATCCAGTCAGATAGAGA
GAGGCGCACCCATGGCGCCCTTATCCGCCTCTTGTCGTGCGTATGGAATCCATAGAAGGATGTATTTTCTGTAAAGAGGTTTTGTTAGTCGTCAAGATGA
TGCTTTAATTAGTTACACAGGTTTATGCGCGATATCCAGACCACTCTAAAACGCTTTGCGTACAGTTGTCCTTGTTTTTCCTAAACCCACAATCGACACT
CACAAACCTCTTTCGACACATCACTCTATAATTCTGTATGTTACCTAACACTAGGTTCATTCATCGTACTTTAAAAGCATTTTTGCCTCCAATAAATAAT
TTGCATGTCTAATATTATAAGCAATCACTGAAACGCTGATTGCGACTGTCTCGTCGCTATGTCGCAGAAGAAGCGCATCCTCCTGCCATCCGACTGTGGC
ACATGGCGATGCGCAGCCAATTCTTCCGTGCCAGACGCATCCTGTAGTGTGGGCGTGCAGATAGAGGCTGCTCGCTCCCCACAA