Description :
From Genome Similarity Track
Location :
Scaffold_558:1535- 6150
Transcript NameFunction/comments
g11662.t1hypothetical protein
g11663.t1POM77273.1 Integrase catalytic core protein [Phytophthora palmivora var. palmivora

Sequence
4615 bases(100 bases per row)
TGATTGCAACCTGATGACCGCACGCCGCGGACATCGCGTACGCCGTTGCTATGTGTCGCCCTTCATTGGAGACCCCCAAGAGAACACTGGTTGCCGGTCA
AGCGCATCTTTCCGCTACCTGCAAGCCACAAGACGCATGGCATCTGCTTCAAGCCGGGCGACAAGATCGACTTTCGTGGTTACTCGGACGCGGACTGGGC
CGGCGACCTCGCCGACCGCAAGTCCACTTCAGGCTACACGTTCATGCTCATGAGTGCACCTGTGAGCTGGGGAAGCAAGAAGCAGTCAAGTGTGTCGCTG
TCTACGAGCGAAGCGGAGTACATCGCGCTCAGTCTGGCTATCCAAGAAGGCAAGTGGATCCATCGTCTGCTGTGCGAGATTCTGGCGGCTGCCAACGAGA
CGGGACCCGAGCTCATGATCCGTGAAGACAACCAGTCGTGCATCAAGATGACCAAGAACCCGGTAAACCACGGCCGCGCCAAACACATCGATATCAAGTA
CCACCACATCCGCGACGAAGTGAAACGCGGTGAAGTGAAGATCGAGTATTGCGAGACTTCTGTGATGCTGGCGGACATCATGACCAAGGCGCTTGCGGGA
CCACGCCACACGGAGCTGACGGCGGCTCTCGGCATTCATGGAACTTCGCATTGAGGGGGCGTATTGAGGGTATGGAGGGTTACCGGTTTGGTATCGGTTG
TTGACCGTGAACCGGTTAACCCGAACCTCAATCCGGAACCCACGCCGTATTACCCACAGGATTACGCCCACTTCGATTACGCACCTGTGGGTTACAAGAT
TGTAAGGTTACAACGATGGCTTCTACGTGGCGCTCTGCTGATTGGCTGGAAGTAAACTCCAGTATCCAGTAAAGAATCAAGTAGGTGGTATCAGTAGGTG
CTGGAGTAGCGGAAGAGCTAGCGAGCCTAAGACCTCAATCAATCACTTCGAACTTTCGTTTGCTACCCCTCAAGTGCTCTTCATCTCCGCTCCGGTCTCG
CCCAGAGTGCTGCCCTCCGCTCGCGCCGTCAAGCTTCACGGTGTCCAAGATCCATACCTTCCATCAGTTCCCAAGCAACCGTGACAAGCGCCGTTACGAC
ACGTTCGAGCTGCTCCACTTCGACATCTGCGGCCCCATGGAAGAAGAGTCACTGGGTGGCAGCAAGTATCTGCTGCTAGTCGTGGACGAAGCTAGCGGAT
GCATGAAGGGGTTCTGCCTGCGTGCCAAGTCGGAGAGCGAAGACTGCATCAAGACATACGTCACGAAGGTGCAGACGCAGTTCGGCAAGAAGGTCAAGTT
TGTGCGGCACGACGGAGCTCGTGAGTTCGCGACCAACTCGCTCAAGGCCTTCTACGAAGTCGAAGGCATCGAGCAGCAAACCACGGTTCCGTACGCGCAC
CAGACCAACGGCACGGCAGAACGCGCCATCCGGACCATCGTCACGATCGGCCGTAGCATGCTGCATCACGCCAAGTCGGACAAGTCTTTCTGGGCTGAGG
CGGCCATGACGGCCATCTACGTGAAGAACCGCCTGCCGTCACCCAAGGTGGAGCACAAGACTCCATTCGAGATCGTGTACAAGGCCAAGCCAAGTGTGAA
GCACATGCGTGTGTTCGGATGCCAGACGTACATCCTGACGCCGAAGGAAAAGCGGCGCAAGTGGGACCCCAAGGCTCGCGCCGGGTTGTTCCTCGGCTAC
GAAGAAGTGTCCAAGGCGTATCGACTTTATGACATCGAGGCGGGGCAGGTGGTTATCAGTCGCGATGTCAACTTCGATGAGTCGGCCTTTGGACTTTCGA
CGCATTACTTCGGATCGAAGACGTCGATGATGCTTCTGCGCTGGACCTGCCGACGCGCCTGACCTGGAGACGACAGACGATGGACCGCGCCAAACGACGC
TTCAAGCAAAGCGGTGGGAAGCGCAAGAGCCGACCGATGGTGGCGACGACACACGTGCCAAGAAGATCGCGCCCGTCGCCACCGAGCTGGCTTGAAAAGC
AAGCTGCGCCGGACGTATCCTCGTCGCGCGAGCTGAACCGACGAAGAAGAAAAGTCTGCGGTACAATATGAAGACGACGACTCGAACCCTCCAGTGTTTT
TGGCGCTGCCAGCTGCCAACGCTGTGGAAGCAGCAGCGATCTATTCGGAGCCGACGACGTTTCCAATGAGCTGTGAACGGCCGCGATCAAGTATGCACTG
GCGCAAGGCGATCGCGCGGAGCTCAAAGTCGATGCGACTGCGTGGTGTGTTTCGAGCTGCCAAGTTGCCCAGCGGCCAGCGTGCCATCGGCACCAAGTGG
GTGTTCAAGATCAAGCGCAAAGCGGACGGCTCGATCGAGAAGTACAAGGCGCGCCTCGTGGCCAAGGGCTTCAAGCAGAAGTACGGCATCGACTACACGG
AGACGTTCTCGCCCGTGGTCAAGTATGTGACGCTGCGCATGATCATCGCGATCACCAAGTACTTCGGCTGGCCCCTCGACCAACTCGACGTCGTGACAGC
ATTCCTGTACGGGGTCATGAAGGAGGTGGTGTTCTGCGTGGTTCCCGAAGGCGTCGAACTGGATGGTGGCTTCGACTGCCTGGAACTAGTGAAGGCCATC
TACGGTCTCAAGCAAGCTTCGCGCGTGTGGAACGAGACCTTCGACGAGTTCATGTGCTCTATCGGCTTCCAAGTGTCGGCCTTTGATCCGTGCCTCTACA
TCAAGGTGGTGGACGGTCAGTGCGTGCTAGTGCTGGTGTACGTGGACGACGTGCTGATTACCGGGAGTTCGCCTGAGCTGATCTCGCGCACGAAGACGGA
CCTGAAAACGCGCTTCGAGATGACCGACAGCGGCAAGTGCGCGTTTGTTCTTGGGATCGAGCTGGCGGACGGCCCGGACGGCAGCGTGACCATGTGCCAG
CGTCGCTACGTGGACGACATCCTGAAACGCTTCGCCATGGACGAATGCAAGGCTGTGGTGAGTCCGGTGGACATGAGCACGCGACTGGTTCCAAGCGACG
CGGCGACCAAGGTGAACGCTCCGTTTCGCGAAGCTGTTGGTGCGCTGATGCACCTGATGACCTCCACGCGCCCGGACATCGCGTACGCCGTTGGCTATGT
GTCGCGCTTCATGGAGAACCCCCAAGAGGAACACTGGGTTGCGGTCAAGCGCATCTTTCGCTACCTGCAAGGCACCAAGACGCATGGCATCTGCTTCAAG
CCGGCGACAAGATCGACTTTCGTGGCTACTCGGACGCGGACTGGGCCGGCGACCTCGCGGACCGCAAGTCCACTTCAGGCTACACGTTCATGCTCATGAG
TGCGCCTGTGAGCTGGGGAAGCAAGAAGCAGTCAAGCGTGTCGCTGTCCACGAGCGAAGCGGAGTACATCGCGCTCAGCCTGGCTATCCAAGAGGGCAAG
TGGATCCATCGCCTGCTGTGCGAGATTCTGGCGGCTGCCAACGAGACGGGACCCGAGCTCATGATCCGCGAAGACAACCAGTCGTGCATCAAGATGACCA
AGAACCCGGTGAACCACGGCCGCGCCAAGCACATCGACATCAAGTACCACCACATCCGCGACGAAGTGAAACGCGGTGAAGTGAAGCTCGAGTATTGCGA
GACTTCTGTGATGCTGGCGGACATCATGACCAAGGCGCTTGCGGGACCACGCCACACGGAGCTGACGGCGGCTCTCGGCATTCATGGGACTTCGCATTGA
GGGGGCGTATTGAGGATATGGAGGGTTACCGGTTTGGTATCGGTTGTTGACCGTGAACCGGTTAACCCGAACCGGTCCAATCCGAACCCACGCCGATTAC
GCCACCAAGGATTACGCCACTGTCGATTACGCCACCTGTGGGTACAAGATTGTAGGTACAAGATGGGCTTCGACGTGGCGCTCTCTCATTGGCTGAAGTA
ACTCAGTATCCAGTAAAGAATCAAGTAGTGTGTATCCAGTAGGTCTAGAGTAGCGAGAAGGCTAGCGAGCTAAAGACCTCAATCAATCACTTTCGAATCT
TCGTTCTACCCCTCAAGTGGTTTCCAGTCTCCGCTCCGGTCTCGCCCAGAGTGCTGCCCTCCCTCCGCTCCGTCAAGCTTCGGTGTCCAAGATCCATACC
TTCCATCACTCGGCGCTCGTGAGGGCAAAGGGCTGTTCAAGCTGTGCATGACTCCGATGATGCCTGACGAGGCCAATGCGGCAAGTTCGAAGGATCGCCA
AGGGGACACCACGTCGTACCTCTGGCACCTCCGACTTGGTCACATTGGCCATGGCGGTCTAGACGCCATCGTCAAGAAGAGCTACGGTGTTGGCATCGAC
ATGACGTCGGTGAAGCAGTGGGAGCTGTGCGACGGGTGTGCACTCGGCAAGCAAACGCGAGTGAGCTACATGAAGTCGTCCCCGAACCGTGCGAAGCACG
TGCTGGAGGTGGTTCACAGCGATGTGTGCGGCCCCATGCAGACGCCAACGTTTGGGGGCAAGCGCTACTTCGTCACGTTCATCGATGACAAGTCGCACTT
CTGCGTCGTGTACTTGCTGAGGAACAAGTCCGAGGTGGCTGCCAAGTTCGCGGAGTTTGTGGCGTTTGCTGAAACTCAGACCGGCAAGCGCGTGCAGACA
CTCCGGAGCGACAAC