Description :
From Genome Similarity Track
Location :
Scaffold_1205:1535- 4826
Sequence
3291 bases(100 bases per row)
CGTTCACCTGGGATCTAGCTTGCCGGTAATATTTCTGGACTTGGTATCGCCATCGTCTTGGATCTCGGTTCCTCTTCTTGGTGCTGCATACTGGGATGGC
CGCTTCCAGGGTGGATTTGGGATCCCACCCATGTACCAAGTAAAATGGGGTATTACCCCGGATCCTGTCTTGGGTGGTGTTTATCGCGAAGGGGAGTCGT
TCTGCGTACTTATCCCAATCCCTCTGATCCAAATCCTGGACATACATCTTGAGTGCTCTCGTGATCGTCTGTACCATGCGCTCGGCCGACCCGTTAGCTT
GGGGACGATATGCCATGATTGCTCGCTGTCGCTGCCCCAGGATCCGCTTGAATGCTTGAAAGAAATCAGACATAAAGCCTGGCTCCCGATCATGTCTAAT
CATTTCGCTAGCTCCAAATCTTCGGAAGACACACTCCTCGTACGATTCAGCAATGGTTTGCGCCGTTCTAGACGCACTAGCTTTGGCTATCACGTACCCG
GTAAACAGGTCCACCCAAATCAACAATTCTGTGTTTCCTTTGAACGACTTGGGCAACGAGAGGATATGATCCATGGCTATGATTTGGAAATGGTAAGTCG
CTTGGATATTCCCAGGTGACTCCCCTTCAATTGTGGGCCTGCCCTTGCCCGTCTCACAATCCACACATGCCCGACATACCGTTGTACGCTCTTGAATAGT
CCCCTCCAGTGAAAACATTCCCGGATCCGTTGGTAGGTCCGACCAATACCCTGATGTCCGCCTTCCAAGCTAGCGTGATAGTGGTGTAGGACATCCTGTT
GTAAGGTTTCCGGCATCACCAGTCTCATCAATCCATCCCGATCCTCGTTGACTCTCTTCGTAGGGGGGGGGGGCAATAGAAGAGCAAGTCATTCAGATCC
ACCGCGTAGTCCGTAGCGATAATGCTGAAGGATTTGGCATCTTCCCGACTCAGGTCTCGTACATCCCCCATCAGATACCTCTTTAGCCCTAGGATCCACG
CTTCCTCGTTCTGTGCTTTGAGGATCCGCTCGATGCGGACTCTCTTCACAAATGTTTCCTCGAGAATTTGGGGGTTGGATCCAATCCTTCCTCTGGACCT
AGTGACGGCCATCACCTGGACTGTCCTTTTCCCGGACCCCACTACCACCACTTCGTCTAGTCGGTTCAACGTAACGAGATCCTGATGCTCGGCCTCTCTC
TCCACTTCAACCCCACATTGATTCCGTAAAGCGGCGCTGGCCAAGCTATCTGCACTGGCATTCCAATCTCGCTTGACATGCACCAACTCGTGATATATCC
AACCGCGCAGGTGGATCATCACTTTCTGCCGTAACAGTGTTAGGGCCGGGGCCTTGCAGTCAATCTCACTTCGCACATGTCTGATCACCAAATTTGAATC
CCCACAAATCACCAGCCTTTTCGGATCTTGTCCCCTTAGTAGATCCAAACCCAGCAGTAGCCCGTTATACTCCGCTTCGTTGACGGTGAGGCGCTTCCCG
CATAAGTGGATCTGGCCCGTACGACTTCCCATCCAGGTAGACGCCACAGTATTGCACTGTACGCCCCGGCCTCCGCGTCGTACGCGAGCGGATCCATCGA
AACTCAGGACGTACAGATCCTCATCTGCCTGTACCGTCGGGATCGGGATCTGGATCCGGCGTTTGGGCTCTTTCTTAGGAGCGACCCTAGTCAGCGCCTC
ATCCATCTTAGCTCGAGGAATGATGCTCGCGGCCAAGACTCCCAGGATCTCGTCTTCCCCTTTCGAACATTTCACAATCTCCAGTGTCCAAGGCGAGAGT
AAAGCTGCCCACTGTCCCAATCGTCCTTGTAACCCGGCCGACTTGAACAGCCAAGCCAGCGTAGAGTGTCGAGTCAGGATCTGGATGGATCTTCCCACCA
GCAGATTGTAATTGAGATCCAACACGCGCAAGAGCGCGAGTATCTCCTTCTCCACCGCTCCGTAGTTCAGCTCATTTGGCTTTAGCGTCCGGCTGACGAA
GGTGACTGGATGACAGATCCCCTCATGTTCTTGTACCAAGGCTGCTGAGACTGCCCAGTCACTGGCATAAACTATAACCGTAGGTTGACGTTCCGGATCG
AAATGACGGAGGATAGGTGTGGTCGCGATCCTGTTTCCTCAGCTCCACGAATGCGTGTTGAGCTCGGATCCACCGAGGTTCCACCATTTCCGAGTTCTGA
TCCGTCGTCTCTATCCTGATTGGATCCTCTTTCCTTTGGTCCCGGGGCGGATCCAGCTCCTGTTTTAGGTCCTCTTCTGGCGTCGTACCACTTGGATTCC
TTCGTGGATCCGGCATCTCCTGGGCCAGAGCTTGTTGGATTTTCATCTGGACAGCTGGAGTGGTCATCGCGGCAAAATCTACCTCTCTCAATTCGTACAA
TACCGCGGCAAACAGGGCGTAATCCTCGATGAACCGACTGTAGTAGTTCAAACTGCCCAAGAAGGATTGCATCGCCCGTAACGACTGCGGGAAGGGCAAA
TCGGCTAACGAAGACAGGTCCTTAGGATTCGCCTCCAATCCCTCCTTGGAAACTCGATGGCCTAAGCACCTTGCGCATCCCCCAATAGCTCTTTACCACA
CTGATAGAGAGATTCCACTTAGTACTGTGGTGTAGTGATTTCTCCGTAGTTGCGGATTATCACCCGTCGACAAAGACGTGACACCGCCCAAGATGTTCAA
GCGACGAACCCTCGGTCAGGTGATGTACGGAGACGCCAAGGTGCAAGGGACTCGACGGCGTTACTCTCGAGCTTTCAACAAAGTACCGGATACGGTCATA
TGTCACTGAATCCAGGCTGTCCTTATTATTAATAATGGACTGGCCGGATTCGCATTCAGCGGACCATCTACGGTACGAACCCTCAGTGGCGGTTGGGATG
AGTTCGCGGAAGACTCAGCGACCCTTGGAAGGTGCGTTCACCGTCTGGGACAGGGCGCGGGCCGTTAAAGATACTCATGCGACGGTGCAGACGACGCTTG
GCATGCAAGAAGATCCATAACGGATCATTGTTCACTTGATATTTGCATACTTGATTAGGACTTCTTATTAGGAATAGACCCGAAAGGGTAAGCTTAAATA
CAGAACAGAATTTCCACTCAAGCACACAGAGCGACGTCCGGCTTCAAGGTAAGCGTCAGGTCAAGCTTGTTTGAGTGTGTTATGCCTGTCGGTGAACTCG
AAGCTCTGTAGCGAGGGTTCATCCGGCAAGGCCAAGAGACTTTGTGTATTGACCGATTATTATCGGGAGGTTTTACGTGACGGCTTATTGT