Description :
From Genome Similarity Track
Location :
Scaffold_4:1534381- 1539227
Transcript NameFunction/comments
Phyin_T30-4PITG_03372Putative uncharacterized protein
Phyin_T30-4PITG_03373Cell division protein ftsZ

Sequence
4846 bases(100 bases per row)
TCCAAGTGGACAGTCGCGCTTTCAACACCACGAGCCGAAATTTGTTGCTGTCTGTCCAGGACACACAGAGACTGAACACTACGCTCGGAGGGTGGACCGA
TGTGCCGGCAACCTTGGGCAGTGCATTGCGATGGTCGCTTTCAATTAGCGTAACGGACTCCTTGAAAGTTTATAGTAGAAACCGTTTGATTGGAGCTGAC
AGCTTGAATAGCTCCAGGTACATCGCTACCGGTATTGACCACGTTCTATTTTGCGAGGTGATCCATTCCCTATGCTGCCGGATCGTGCTCACTGACGTGG
GCATGCGTGGTGGTGGGCCGCCACTGGCGGCTTACAGTAAGTCTTCTGCCGAGCTCGGCTTCCAAGGTAACCGGTACATGACTTTACGTTAGGCTCCAGT
AGAGCCATAGCCACCAGCTACAGCTTTTAAAGTGGCGACACATCCAATGCGCTGGTTTCTAAAAGCGTCGGTGGTTCTTCGCAGTTTTTCACTAAACTGA
GCTTGTTGAATTAATTTGCACCGCTGAATACGATTGAGTTTCAGTGAAGACCGAGTGCGTGTCCTGCGTTGCAGAGGTTGCTGCGCCACTCGCCTGTCTG
ATGTCAGGGCTGAACTAACGCCGTGTGTGCGCGACACCCGCGGCAACTTTGTCAGGAGCCCAAGCCCCCCTGTCGAAATACCACACAAAACCCAGGTGGT
TGCACACTTCGACGGGTGCGTAACTCTGTCGTGGCGACGTAAACGGGGCCGATCACAATTTCGATCGGCACCATCCAGTAAGAGCTCGACGCCACACTAT
CCAGACTGGATTCCAGCGTCCGCACGAGCTGACGCAGTCGGTATTTCCAACCAGCCACCTCACGTCACTCTCCGGAGACGACGTACACAAAGCCCGCCCC
TGCTTGTAGAATTCGCCAGCTCTGCACGTCGTATAGGATACCCCTGCGCCCGTCCAAACCAGGAAGCGACCGACAGAACGAGACGAATAAATCGCACCGG
ACCATTTAACGTAGCGTAGCGCAGGACAACTACAGGCGATCATGAATATGTTCCAGAGCGGAGTGCAGGTGTTCATCCCTGCAGCACTAAACCGGCCCAC
ACACACGCTTTACAGCATCTGTATGCTGGTGCAGCCCACTAATCAGGAATGGACAGTCAACCGCCGCTACTCGCAATTCCTACAGCTGCGCAAGGACATC
CAACACAGACTCGCCACGCGCGGCGTCTCGTGTGCTAACTGTGCTAGCTTCAACCGCGCCATCAGCAAGTTTCGTTTCCCGAGTAAGTCGCTACTCCGCA
CCAACACGGTGGTGCGCCATCGTGTCTCGGCCCTACAGGAGTTCCTCAAGCTGCTGGTGGGGCGTGTGTACAACGATCTACCTAAGTGCGGCATCTGTGG
CGAGGAGATTAAGGACATGATGCGGCCATTTCTTATTCGAGGAGCGCAACCCCTGAACGGCTCCATCACATCGAAGATCAACAAGTCGCTCTCACTCGAC
TCGTACGCAGTTGTGGACCAACCCGTGGTGCCCGTGCCCGAACCGGCCCCGCCCATTTCGCCCTCGCTGATGAGCAGGGAACTCTTCAGTGCCAGCAAGT
CGTCCAGCAAACCCATTTTCACAATCAGTCAGATTTCAGGTAGTAAATCCATTTTCTCGCGTAGCAAGGCGATGATGAGTACTACGTCGGACGACGCTTC
CACACAGCCAAACGAGTCGGAGGACCCCATTATGGACTACATGTACTCGGAGAGCGATGAGGACGGCTACGGCAAGAAATACGACGACCAACGTTGCTAC
GATGAGGCTGTTCCTCTCGAGGAAGCTATGAAGCAGGTGGTGGTGCCCCGAGGCGTTAGTCTTACGTGCGAAGAAGTGGTTGTCCGGCTTACCTCAATGT
GGGCTGCTTATGATCTGGATGAAGCACTTTCATCCTTACCGCCCGAGCGGCTTTCACAGCAGGCCAACTTCTCCGTCGACGATAAGGAATACGCGTTTTA
AAGTGTATTGTTGGGGAGCCAATTTTGCTTTTCCACCTCAAGGGGTGACTGCTAGCCGGCCAACAGAGCCGCATCGCTTAATGGGCAGAGCATTGTGCAA
AACTAAGTATGAAGCAGTCCGTATAATACCAATCCGATCAGCACGCGCGGGTGCGTGGAGACATCGATGCCACTTCAAATTGTAGAGATTTCTTGAGCAA
TCACGTCATTAGGTGTCATTCCCCTGCTTACGCTTTGATACTGGCCAACATCACGGCTTCTATAACTTGTCGGGGTCGGCAATACCAGTGGCAACCACGG
AGACGCGTAGCTTGCCGCCCAGCGAGTCGTCGAAGGTCGAACCGAAGATGATGTTGGCGTGTGGATCATCAAGTTCCCGCGTCACACGCTCAGCAGCCTC
ATCAACTTCAAATAGCGTCAGGTCGGAGCCTCCCGTGATATTAACGATCATGCCCTTGGCGTCCTGCGAATCAGTGAAGAAAGGTTAACACATCGATCCT
GTTTTTTCAAAACTACCATTTACACAAGCAAGCGTCGAGATTCAGTGCATACCTTAATCGAAATATCACCCAGAAGAGGGTTCGCCAATGCATCTTCAGC
AGCACGCAGAGCCCTACAAACCGACACAAATGCAAGCAACCATCAGACCATCGCGTAAGCTATTCGTCGACAGCAGCAAGACGCACCGATTCTCTCCATC
GGCCTCTCCACTTCCCATCATAGCGTTTCCCATATTTTGCATGACCTGCAGTTACGAGATCAGTAAATACAAAAAAATATACCTTCAAGAGAAACTGATT
AAGCTGCGTACCGATTGAACATCCGCAAAGTCAAGGTTAATGAGCCCAGGCATCACCATCAAATCCGAAATGTTCTTGACACCGTCCAGAAGCACATTGT
CCGCCATTCTGGGAGAAGATAAAGTGAGGGTGGTAATCGTAGTGAATCGACCTGCTCGAGCCACGCACCTGAATGCGTCCATCAACGAGGTGCGCTCATT
TGACATGTTGAACAAGTTTTGGTTCGGGATCACAAGCATCGTATCGACGCTATCCTTCAGTTCAGCGAGGCCTTGTGCCGCAAGCTTTGCACGGTTGTTT
CCCTCAAACCGGAACGGCTATGATGTCAATAGAATCGAGGGTTAATAGATCACAGCATTAAGCTAACAATGTTACGTGAGTGAATGAATACCTTAGTAAC
GACAGCTACGGTGAGGATACCAGCATCTAAGGCAGCCTGAGCAATGACGGGTGCTGCACCTGTACCTGTTCCGCCACCCATACCCGCAGTAACAAACATC
TATATAGGGGCAGAAAAGCAGAAGTTAATAATCATATCGTTGTCATCACCAAGTCATTCGCTCAAATCGGAACGTCTTGAGAAACGCAATGTCACCGAGA
CAAACCATGTTTGCACCCTGAACGCGCTCCAAAATCTCATCAATCGCGGCCTCTGCCGCCTCTCGGCTAATCAATAGTTAAGGTCAGTATGTAAGAAAAA
AAAATACCGCTTTTACGCAGTCACTCACCCAACTTCGGGGTTAGCGCCACAGCCCAGTCCTCCAGTCAATTCAGGAGCCATCTGAACGCGGTTCTCCGTC
AGCGTCGTGCGTAAGTGCTGAGCATCCGTGTTGCAAACAAGAAACTCCACACCCTGCAGGCCGCGCGCGATCATGTTGTTCACTGCCAGTTCACCACGAC
CCGTCGGTAGAGTCGATCAGCATCAATTCATCCCACCAGCCAAATAACTCTTCACTATTAGCAAACAAACCCGCATTTCCTCCAGCTCCTCCGACGCCAA
CCACCACAATCTTCGGTGCAAAGCCCGACAGGTCTGTCACAGGATGGTCCTGTGTGAGCCAAAGTGGCTGTGTGGAGCTCATGGCTGGCGGCACGAGCTT
CTTCTCTACTACTGGCGTCGAAACGGCGCTCACATCTGTTGGTGAATCGGGCTCTGCCTCCAGCCCCACTTTCACACCGCCATCCTCGTCTTTTCGAGCC
TTTTTAAAGCCCTATAAGTCAGTAGAACCTGTCAGACGCAGCATTCTCAATACATTTCCCAGAAACTTGTGTTTTTACCATGCGTAACGCGGCAGCTGCA
GCATCAGTGGCTTCAGTAGAGAAGGCGAGGTGTTGAGTGGCGGACTGGGAGGTCTGGCGGGCACGTAGCAGCGCCATCGCCGCAGCTTTCATGCGGGATA
TCGCCATCACGAACTGGATCAGAGTTTGTGGCACGAGCCGATATCCTAGGTATTTGCATATTCATTATTAGAGGTCTTTTCATTTTAGTGTTTACCGGTA
TTAATTTATTTTAATTTAATACTTGAAGTATTTTATATTTTTCAAGCCCTTTGATCCTGGTGGCGTAATTCCTCCACGTTAGCCTTGATGTAAAGCATCA
CTTCTGCCTCAGTTAAGTCTAGCTGGACGCCGTAGTTACGTCCCACGAACGTGCTGAAAGCGTCAACGTCCGAGCACAAAAGGCGTCCTGTGTCGGTCCA
GATGACCACGTCACTAATCACCAATTTCGAAGAGGTAGGCAAGTTGAAGCTACATCGAAACGTTAACAGCAATACAGGAAGTGCACTAAACTAACTTATG
CTTACTTACCCATAACGACGCATCAGCTCGGCCGCATCGTTTGGCCAGCGATCGGCTTTCGATGGCAGCTTGGTAACTTGGCAATCGGGCAACGTCGTCG
CTAGAATGTCTGCACAGCACCGTAAGCGAGAATGACTAATCCAATTTTCTCTACATCCAGCAAAAGTCATAACCGTACCGAGTAAGCGATCACAGACAGC
ATACTCTTCGCTGTTGACTCGCCCAGCCAACGTGTAGTGCACCATT