Description :
From Genome Similarity Track
Location :
contig_18:153433- 154435
Sequence
1002 bases(100 bases per row)
TATTGAGAACAGCACTCTCACAGCTTTCGGTATGATACGGTAGTCGCCTTGGTGCTCAAGTCTTTGCCAAAACTCAAGTACTGATTCATTTGGTGTGTAG
TCCTCTTTTCGTGCAATGTCGACAGGATCTTCCAGCCATCGATCAAGTTCCTCTTCTGCGCGTCGATCCTGCCGGCTAAAGGTTGGTGGTCGGCTTGATC
TCGGCGCAAATTCTGCTTCCAGTCGACTGACTTGCACAACAGGTGCAGGTGGTTCAAATTCAGAGACGTCCGCGGGTTCACTTACTGCCTTAAGTAAGTC
CAATAAGTTGCAGCGGATTTTGGCGTTCACATCATTCTTCCTGGTCACAGCATCCCTTCCGCTTTTGCCATGCTGACGGCACGACAAAATCACTGCACGA
TCGAGGCTCCTCTCCGTTCGTTTGAAGATAGGGTGGAGTTTCAACTGCATTTCAAATACAAATTGACACTTGTGGAATTGCTTGTCGTTGTAATATCTGC
TGAAGAAGCGTTCGTCCAATGCTCTCCGCAATAGTCTCCGTACATCCGCAGCCAGTGGTGTAAGGTCACTTGCAGGAATCCAACGAGGATTTTTGTCGGT
TGATAGGTAGTGTGGCAAAGGCTGATCAGGGTCGAGGTCGTGAATACGCATCATATACAACTGTACGAGCACGTCGACTTGAACAGGATGCTCTGCTTGA
CATGTTCGCTTGATCTCACCGATTTGCTTCAGCACAGACAACACATGAACCAAGTCGTCATGGCGATTAGCCAACGGGAACTCTGGTGGTGGCTGGTTGG
CACGAAGTGCTTTACGAGCTCGCTCTTCATACCACGCAGTTATTGCTGGCCACTTCTCAAGAACTCTCTCCAATGAACGCGTCATGCTCAGGAAACGTGA
AGTAGAATATCCAACAAGTCGCGTGGAGGCACCCTGAGTCTTAGACTTACAGAGCTCTGCAAATAAGCTCCCAGTGACAGACACGACCTTGACCTGAAAT
AT