Description :
From Genome Similarity Track
Location :
contig_18:153432- 154434
Transcript NameFunction/comments
g4596.t1hypothetical protein

Sequence
1002 bases(100 bases per row)
CGCCTTGGTGCTCAAGTCTTTGCCAAAACTCAAGTACTGATTCATTTGGTGTGTAGTCCTCTTTTCGTGCAATGTCGACAGGATCTTCCAGCCATCGATC
AAGTTCCTCTTCTGCGCGTCGATCCTGCCGGCTAAAGGTTGGTGGTCGGCTTGATCTCGGCGCAAATTCTGCTTCCAGTCGACTGACTTGCACAACAGGT
GCAGGTGGTTCAAATTCAGAGACGTCCGCGGGTTCACTTACTGCCTTAAGTAAGTCCAATAAGTTGCAGCGGATTTTGGCGTTCACATCATTCTTCCTGG
TCACAGCATCCCTTCCGCTTTTGCCATGCTGACGGCACGACAAAATCACTGCACGATCGAGGCTCCTCTCCGTTCGTTTGAAGATAGGGTGGAGTTTCAA
CTGCATTTCAAATACAAATTGACACTTGTGGAATTGCTTGTCGTTGTAATATCTGCTGAAGAAGCGTTCGTCCAATGCTCTCCGCAATAGTCTCCGTACA
TCCGCAGCCAGTGGTGTAAGGTCACTTGCAGGAATCCAACGAGGATTTTTGTCGGTTGATAGGTAGTGTGGCAAAGGCTGATCAGGGTCGAGGTCGTGAA
TACGCATCATATACAACTGTACGAGCACGTCGACTTGAACAGGATGCTCTGCTTGACATGTTCGCTTGATCTCACCGATTTGCTTCAGCACAGACAACAC
ATGAACCAAGTCGTCATGGCGATTAGCCAACGGGAACTCTGGTGGTGGCTGGTTGGCACGAAGTGCTTTACGAGCTCGCTCTTCATACCACGCAGTTATT
GCTGGCCACTTCTCAAGAACTCTCTCCAATGAACGCGTCATGCTCAGGAAACGTGAAGTAGAATATCCAACAAGTCGCGTGGAGGCACCCTGAGTCTTAG
ACTTACAGAGCTCTGCAAATAAGCTCCCAGTGACAGACACGACCTTGACCTGAAATATTGTTCTTACCATCCGTGAGATTAAGTCCGCCATCTCCGGGTT
AG