Description :
From Genome Similarity Track
Location :
scaffold_76:153422- 155868
Transcript NameFunction/comments
g7380.t1 hypothetical protein PHYSODRAFT_477036
g7381.t1 hypothetical protein PHYSODRAFT_284006

Sequence
2446 bases(100 bases per row)
GATGGATCAATGCAATCCGTGGTCATCCAGCGGTCAGGAAGACTTCAATTCCGACGCCTCAAGTGGCTTGTTAGAACAGATGCTACCTCTGCATCTCGAC
GAGCCTCGGCCGCCTTCACCCCCTGCATCCCCACGAAAGGGCCCGACCACGGATCACTTGAACCAGTCGCCAATGACCACCATCGACAAGAAGAAAATGC
AGTTGCAACGTTTGCGCGCCAACATCCGAGTACGTTGATCTTACCAAATCTATCAAATACGCATTCGTATTAATCGATGCCGCTCTTGCTCGCAGAGGGA
AATGCGCGAGGAGGACAACTGCAACATGTAGGCGAGTGTAGGCATCAATCCGCTGAATGTAGCCATTTATTGTATGATAGTCAGTGTGCACCACACTAAA
CCACGTACCATACACCATTTTACGAAACGGAAGCGCCAGACTGCATTCTTGGAAAATCTGAAGAGTCGAGCTGATAGTCACCAAGTGACGTCGCTGTCTC
TCCGTGTCTGTCGCCCCCCACGCCCCAGCTCCCTCCCATCACTAACCTCTTGTTAGCTGAAGCACCAGGCTACTTGTCTCCGTTGCAAGTGCGCCATAAT
CCCCCGAATTGACGTCACCAGAGCTGAACGATGGAAGGCCAAGTGGTGGAGCTCACCGAGGCCGAGCAGGCCCAGCACCAGCTGCAGATGGAGCAGCAGC
TCAAGTCTTTCTGGGCAAAGCAGCTACTGGAGATGGAGCAGCTCGAAGTGGGCAGTGAACAAGGTGCCGTGGACCTAAAAAATAGTTTTTTGTGACGCAC
GGACACTAACTTTGTGCACGATCTGCGACCTGGTGACAGACTTCAAGAACCACAACGACCTGCCACTCGCGCGCATCAAGCGCATCATGAAGTCGGACGA
GGACGTTCGCATGATCAGCGCTGAGGCGCCCGTGCTGTTCGCCAAGGCCTGCGAGATGTTCATCCTGGAGCTTACGCTGCGGTCGTGGGGCTACTCGGAG
AAGAACAAGCGGCGGACGCTGCAGAAGGAGGACATCCAGACGGCCATTAGGAACACGGACATCTTCGACTTCTTGGTGGACGTCATCAACTAAAGAGGAC
GCGGTAGACACACACCAAGCTCGACCGAGTCTAGCCAGTAGCTGCCAGAGATGATGTAGAAGAGAGAGTGGGTGGAGACTGGGAGAGCTGCAATATAGCG
CTTGATAGCAATGTCAATGGAGGCTTCATGTGGACACTTCCTTGGTGTCCTCCGTTGTCGCGTGGAGTGGTGCACACCAAAGACCACGTCATCTCAACCT
TGAAGTACCGGGACAGCGTCATTCTGCTACGCGGACGCTCTCCGCTTCGACAGCGGCGCTATATGCTGCTGTGTAGTACGATCCTGCCGCTATGGGCCTG
GTCGCGAACCTCTACACCTTTTTGGCGGCGGCAATTCAGCTCACAGAGGCAACAGTATCAACTTGGGTGTTGAACCAAGGCAACGAAGCCCGTCGGCAAA
GCCAGACCCGTCACCGTCTACCAGACCAATTCCAGCCATACTTCCTCAGCGCTAGCATGGCATCAAACTCAATTAGTGCAACACATCCCACGTACGGCAG
GCAGCAAGCAGCTTGCAGTCCTTGCGTTTCGTACTTAGCCTAGCACGGTCGCCACGTTCCTAACTTGAAGTTGCGAATATCGCGTCAACTGCTTTGCGTC
ATTCGCCATTATCCGTCCAAGTCCCCCTTAAGCCTCAATGCTGCACACGACCTTCCTCCGCTCCTCGCACGCGCTTCGCTGCTCCACACTGTGCCGGACG
TTGTCCACTGTTCGCTCCAAGGACCAGGTGGGCGTCATCGGTCTGGGCCAAATGGGCGGACGCATGGCCGACAACCTCCGCAAACACGGCCACAAGCTTG
TCGTGTGCGACCCCGCGCCCGCCAACGTGCAGAAGCAAGTGGAAAAAGGCGGTGCTGTGGCCGCCTCCACGCCCGCCGAGGTGGCCGAGCAGTGCGACAC
CATCATCACCATGCTGCCGTCCACCGCCATCGTCGAGAGCGTTTATCTGGGGGACGAGGGTGTCCACGAGGCGCTGCGCAGCGAACACTTGCTGCTGGAC
TCGAGTACCATCGACCCGATCTTCACCAAGAAGCTGAGCACCAAGCTGCACGAGCTGGGGGCAACGTTCGTGGACGCTCCGGTGTCTGGAGGTGTAGCAG
GAGCTCAGAACGGGACGCTGACGTTCATGGTGGGCGGCGAACCGGAAGAGTTCGAGCGTGTCAAGCCGTTGTTGAAGGCCATGGGCAAGAACTTGGTGTA
CTGCGGTGGAAGTTGTACGTAGTTGGAGAATATGGTGGCTATAGGAAGTGTGCTGAGTGGGTTGTGCGTTTTGGATTGTAGCTACGGGGCAGATCGCCAA
GCTGTGCAACAACCTGGCATTGGCGATTCAGATGGCGTCGGTTGCT