Description :
From Genome Similarity Track
Location :
Scaffold_93:153422- 155408
Transcript NameFunction/comments
Physo_141046hypothetical protein

Sequence
1986 bases(100 bases per row)
ACCATTACGGATAGCGTCCACCACGCTACCCGCCAACACCGCCTCACTCTTCGGCAATGTCGGCTTCTCCACGCGATTGCATCACATGGAACCTCTGCCG
GCTCCGTCGCTTCTGCTGGAAGTCGAACAGCAGACCACCACAGTTCAGGTGTTCTTCCTTGACCCAATTCGTCTCTGCGTGGCCCTTCCAACGCACCAAA
TATTCCTTGAGCCGTCGACCGTAGCGGGTGCGTCTTTCCGTCTTGACATCCAAGATCTCTTCAACTTCATACTCGTTGTCACCGCGAGTTTGTGCCTCCC
AGCTATCCTCGGGGAGAAGTTCTTCGTCAAAGTCAAATCGTTCGCTTTCATCAACAGTGAGATCTTCGGCGGGTCGTTCGGGGAACTGTCGGACCAGCTT
CAGCTTCGAGATGTGTACGTTAGGGAACAGTCGGTAGTCAGTCCCGCTGATTTCCAGCTTGGCAGCGTAGTCGCTCACCATGGTGGCGACTCTGAAAGGC
CCATGCCACATGTGAGCGAGCTTCCGAGCGTATCCGACCTTGACTCAGTCGAGGTACAGCCAACCTGCGATCCCTCCGTAATGGGTGACTCCAGTACATT
CTCATTGTGGGCTTCCGCGCGACTCTCACGAGCTTCGGCGAGGAGACGACGAGTCTCTGTCTGAGCACGTTGGTATTGGCGTTGATCTTGAACCTCCATT
TCTGTGGGTCGAGATCTCGGCTTCCGGTCCCTCCAACAGCCAACGATGCCTCAATAGACGATTTAGGGTCTCACCCGTGCAGCAAAAAGAATGGCGTGTC
CTTGCGTACTCGGTCGTGCGATGTGTTCAACGCAAACACCAACCGCTCCGCATATTCATCCCACTCCTGTTGGTTCTCGTCGTCAACGTACATCCGCAGA
GATCTGGAAATAGTCTGGACCATCCGCTCCGCTGTGCCGTTTGCTTGAGGTCTATACGCGAGCGTAGATCGCTGACGCTGGCCCAGCAGCGCATTAAACG
ACCGGAAAAAGTCGGACATGAAGCTCGGTTCCTGGTCGTGCCTGATTACTTCGCTGGCTCCGTACCGCCGAAACACGCATTCCTCGTATGCCTCAGCCAC
TGTTGGTGCGGTCCTGTCCGCGTTTGCCTTTGCCACAACGAAGCCGGTGAAGAGATCCACGAAGACTAGGAGCTCTGTGTTGCCCTTGAACGACTTCGGG
AGGGTGGGGATATGATCTATAGCCACGACCTGGAAAGGGTAATCAGCGGCGATATTGCCCGGCGATCGCCCCCGCAAGGTGGGTTTTCCTTTTCCCGTCT
CGCAGTCGACGCACTCCCCGACATACTTCTGCACACTTCAGAACATACCTCGCCAGTAGAAATGCCTCCGAAGGTTTTGGCATGTTCGGCTGACTCCCTG
ATGACCTCCCTCCACACTTGTGTGGAAATGATGCAGGAGATCTTCGTGGAGTGTACTCGGCATTACCAGTTTCACCATAGATCCACGGTCCTCGACATCA
CCACCGCGCCCCTCGACTGGACAGTACATCAAGAGACCATGCTCGTCGACCTCGTAACTGTCAGCCAGTTTACTGCACGTCTTGGCTTGACGGCTCGAGA
TCTGAGAGAGATCACCGTGCAGGAAACACTTCAGTGACCAGATCCACACCTCCTCGTCTTGAGCACGGCAAATCCGTTCCAAGCGCAGCTGCTTGACGAC
GTCTTCCTGCAACACGGCTGGTGCGACAGTACGAGATCGGCTTCGCGTGACAGCGCCTACCTTCGGATGGGCGTCACGTTCTTCGCCCGTCTTGAGGAGC
TCGTCCAGTCGATTCAAGGTCTCGAGGTCCGTGTAATCGGTGTGACTCTCGACAACTACCCCGGCACCACGCTGCAGCGCCTGTCCCGCCAGCATATCCG
CGGGTTGGTTCCAATCGCGTTTTACGTGGATGAGTTCGCATTGCGGCCAAGACCGCAAAATCACTCTGGCCTTCTCACGCAAGAGC