Description :
From Genome Similarity Track
Location :
contig_18:153403- 158555
Transcript NameFunction/comments
g4385.t1POM73980.1 Hypothetical protein PHPALM_9113, partial [Phytophthora palmivora var. palmivora
g4386.t1hypothetical protein

Sequence
5152 bases(100 bases per row)
ATCACGCTCAATCTGGCACGAAGATACTGGTATTGAGAACAGCACTCTCACAGCTTTCGGTATGATACGGTAGTCGCCTTGGTGCTCAAGTCTTTGCCAA
AACTCAAGTACTGATTCATTTGGTGTGTAGTCCTCTTTTCGTGCAATGTCGACAGGATCTTCCAGCCATCGATCAAGTTCCTCTTCTGCGCGTCGATCCT
GCCGGCTAAAGGTTGGTGGTCGGCTTGATCTCGGCGCAAATTCTGCTTCCAGTCGACTGACTTGCACAACAGGTGCAGGTGGTTCAAATTCAGAGACGTC
CGCGGGTTCACTTACTGCCTTAAGTAAGTCCAATAAGTTGCAGCGGATTTTGGCGTTCACATCATTCTTCCTGGTCACAGCATCCCTTCCGCTTTTGCCA
TGCTGACGGCACGACAAAATCACTGCACGATCGAGGCTCCTCTCCGTTCGTTTGAAGATAGGGTGGAGTTTCAACTGCATTTCAAATACAAATTGACACT
TGTGGAATTGCTTGTCGTTGTAATATCTGCTGAAGAAGCGTTCGTCCAATGCTCTCCGCAATAGTCTCCGTACATCCGCAGCCAGTGGTGTAAGGTCACT
TGCAGGAATCCAACGAGGATTTTTGTCGGTTGATAGGTAGTGTGGCAAAGGCTGATCAGGGTCGAGGTCGTGAATACGCATCATATACAACTGTACGAGC
ACGTCGACTTGAACAGGATGCTCTGCTTGACATGTTCGCTTGATCTCACCGATTTGCTTCAGCACAGACAACACATGAACCAAGTCGTCATGGCGATTAG
CCAACGGGAACTCTGGTGGTGGCTGGTTGGCACGAAGTGCTTTACGAGCTCGCTCTTCATACCACGCAGTTATTGCTGGCCACTTCTCAAGAACTCTCTC
CAATGAACGCGTCATGCTCAGGAAACGTGAAGTAGAATATCCAACAAGTCGCGTGGAGGCACCCTGAGTCTTAGACTTACAGAGCTCTGCAAATAAGCTC
CCAGTGACAGACACGACCTTGACCTGAAATATTGTTCTTACCATCCGTGAGATTAAGTCCGCCATCTCCGGGTTAGCTGCAGCACTAGCAGCTCCATTTA
CACCACATGATGACTTTGTAGCTGCGTGGGCCATGTGTGCGAAGCACCACTCCCAGTGCAGATTGAGTTCTTTGCACAGCATCGATTTCACGTCACCCCC
GAGTCGCTCGTAGCCCCGTAGAAATCGCTCGTCGCTAAGCCAAAGTCCTCGAGCATGTGCTTCAACCACCCTTTGAAGGGCTTGACAATGCCGCCATCAC
GATCTCCATATGCGGGGTTGAACTTTCTCGTTCCCAAGAGAATGGACTTGTACTCCCAGGCCTTGTCCACCAGGTAAACCCGCAACCCAAGAAATTTGTC
TTGCGTTGTTTTGCAAGTCCAAAAATCTGCCACGAGCGTAAAGTTCGGGTAGTCCTCTCGGTTCTCTTGGAGGTAGTTAGTGATCTCCTTGCGTGTTGAA
GAATACAGCTCCACGATAGATTCCTTCACCTGCTTTGTAGTTATCTTGGCCTTCATCTCGTCCTTATAGAGTAGCGCTTGGATTAGTCTTGCCTCTTCGT
ACTCCACCATACGAAACGTCAAGTTATGGTTGATGATCATGAGAGTGGTCATCAGCACGTTTAGCCGGGTTGGGTTGTTTGAGTACAGGGCGGACGATGA
CAGGTGGTTGTAATCATGGTCGTGTTTGCGCTTCTTGACGGTCGCTATCTTTGTTTTCGGCGAGCCAACGTTGTGTATCTTCTGGAGGTGCTTCACGGCC
ATGGTCGTTTTGCCAGCATAGAGCTTGAACAGGTTTTTTCCTGACGTCCGACACGCCTCGTCGGCCAAACAAGCCCACGCGAAGACCTCCTTCTCGTTCT
CGATGTACTTGACACGAACCCCCCACTTGAATATGTACGAAGTCTCCTTTGGTCGTGGAGGCACCAACTCGAAGGGTCCAAGGGCCTGGAACTCTTTCAC
TGCTTGGAGGACCACAGAAGGTGGCTCTGTCATCGTCACGCGTTGGCTGGAGGTGTCGTGGGTCCCTGCAGATGTCACGAGTGTGAAGTAAGTCCCCGAT
GCGGTCTCTAGTCTTGTCGGCTGCGCTGTGAGCTCGATGCTTGGCGGCGGAGCCTCTGACCTGAAGTCCGAGGACTAAAGCTGAGGCTGGAGGCACAGTG
AGTCCCTGCGGTGGCCACGAGTGTGGGTCACAGGTGGATTTAGTCCATGTACTGCTGCTTCAGGCGGAGTCCTCTGACCTTCTCCTGAAGTCCTTGACTT
GATCCGTGTGCTGGAAGGTGCCGTGGTCCGTGTGGTGGTCACGAGCATAGACTTGCGGTGCTCAGGGTCCCTGGTGTGATCACGAGTCTGTCGGCTGCAC
TTCGAGCGCGTCGGAGGCTCAGCACATGCGAACGCAGGCCGCTTCTTGGGCAGAGGATATCTTCGCGAGTGAGCTCGATAAATTTCAGTGCGGCTGTGGA
AGATCGTGCGATTTTCAGCCAATCCAACGCGTAGGATACGAACACGCCAGATCCGCATAAATACGAAATGCGCGAGAACGAATATCGGGAGGGAAGCTCG
CAAAAATGTTCGTTGTTCTCGCACTTTAGCGAGGAGAACACGAAAATCACGTTTTTCATGTTCCCTCTTTTTCGTGGAAGCGTTTTTCACCTTTTTTTTT
GTTCCCCTACCCGCATGTTCGTCCAAGGCTTGCAAAAAACCGTCACGCCGGACTTGTGGCCAGTCGCACCTCATCATTTAAGTGCTCGACTTTTCAGTGT
CCGCCACAAGATTTGAGAACAAGCCGAAAACGTTGCGTTGGCATGGTTGCACACGCCAGTCTGGCCTCTTTCGACCGATCTGTCGCATATATCAACGTGT
AGTCTTGTCAAGTTGCGGCGTTGGATTCTTTTTTTTTTTGTCGTCGTAGGTAAATACTCGTGGCGTATTAACCTGGACCTCTTTTCGACTTAATGGCGCG
TGCCTCAGGTGAAACTCAACTAACTTCAATTTACCGCGGGGTACAGAAGAAAGGCTCAACTCGGAGCTGAACGACATTACGAGCCAAAAATTCCTGCAAG
TATGCTGCAACTGAGGAGGCTCACGCACAATGAAACGAAAAAGATACGACCCGAAACACACAATCGATAGCTTGAAGTCTGCGCCTGTGGGGCACGTCTC
ACTCGGCATTTTGCCAGATTCAGCACAAGAAGCACTACACCCGCCAAGACGGATGACATTCGACCACTCCGTCATTCCCCTTCATGAAGAAATTCGGGAC
CCACTAGCAACTTCGACTTCCAACGAAACTGAGAGCACGGTGGATGACCGATATCTTCCACTCAAGACAAGCAAGTCTAACGACTTATGCAACCAAGAAG
AGCCGCTAAGAAAGCCTCTTGACTACAAAGAAAACCCACTCAATACTGCTGGTTTTCTTTCGATTGCAACGATGTGGTGGATGCATCCACTCCTGAGGCG
CGGATACCAGGCACCATTGGATGAGGACACTGTTTGGGACCTCCCTACGGCTGATCAAGCACGCCAACTCCAAGAAAAGTTTAACGTATCGTTCGCTGCA
GAATCGCAAAAAGTCGAGGGACAAACAATAGCGAATCCAAAGCGACCGAATGTGAACCGAGCGATTTGGGAGAGCGTCAAACAAACCTGGGGGGTTGCAT
TTGCGTTGCACCTGATAAGCGCAGGCCTCATGCTCTTCCAACCGTTCTTGATCAAGGCCATTCTCAAGAACATCAAAGGCGAAGACAATTTTCTTGGAAT
CTCTTCGGGATACGTACTGGCTGTACTTCTTGGTGTTGCAGCTTTCTGCAGTGCTACGACCATTAGTGCAGGACAGTTTTTGACAACTCGGGTGGCTTGC
AACGCCCGCATGATTGTTGTCAATAGCGCATTCCGCAAGATTCTTCGGCTGTCGGCTACCGCTCGACGAACGATGGATACGGGAGAAATCGTCACCTTCG
TGGGAGTTGACAGTGATCGAGTTGTGTCAGCTTACAAGCTTGGGATGTGGTGCATCGTGGCGCCACTGATGTTGATCGCTGTGAGCGTCCTGATTGGAAC
GCAGATGGGGATTTCTGTCGCTCTGGCTGCTGCAGCGGCAAAAGTGATGACCATATACGGAGCTCTCGCGATGTCCAAGCAGATCGGACTCTACCGCCGC
CAAATTTCCCGCATTGGTGCAAACCGACTGAAGCTGACGAACGAGATGTTGCAAGGCATTCGAGTGGTCAAGTTCTACGGATGGGAAGACTTTGCCAACG
AGTTGATTCACGAAATTCGCCAGAAAGAGATCGGTCTGCTGCGCAAGTACAATCGTCTGCGCCTCGCTAACACGGTATTGATGTTCTTGGCACCAACACT
ACTCAACTTGGTCTGCTTTACTACCACAATTGCGCTGGGCAATAGCTTGGACGTGGCGACGACGTTTGTTATCCTGGCACTCACCAATGCATGCCGTACA
CCCTTCAGTATTTTTGCGGATGCATCGATGGCCGTAGCAGAGGCGATCACATCCACCAGTCGGCTGTCAGATTTTCTCGCTGCGGGGGAGAGCTCTCAGG
ATATCAAGCTAGACACTAATCGAGGTGCGTTACCGTTAATCTCGATCGAAAATGGCGACTTCCGATGGGAAGACGAAGCCACTGCGCCGACACTCTCGAA
TATCAACCTCACGCTCCAACCTGGTACTCTTACTGTGGTCGTGGGGGCTGTTGGTAGCGGTAAAACTAGCCTCGTCAATGCAATTCTCGGCGAGATGCAG
CAAGTTCGCGGGACGCGTGTGGTTCGTGGAGACATCGCATACGCGAGCCAACAAGCGTGGATCCAGCACCAAACAGTGCGCGAAAATATTCTCTTTGGTG
AACCTTACGATGAAGAGCACTATCGCCAAGTGATCGCAGCGTGCCAACTAGCCCCAGATTTTGCGATGTTGGAGCAGGGTGACCAGACAGAGATTGGCGA
ACGCGGCATTAACCTTAGTGGAGGCCAGAAGGCTCGGGTTAGCGTGGCTCGGGCAATGTATCGTGCTCACAAGTTCGATTTTGTTGTTCTGGATGATCCG
CTGAGTGCCCTTGATGTTCACGTGGCGAACGCGGTGTTTTCAGATGGATTGG