Description :
From Genome Similarity Track
Location :
contig_18:153402- 158469
Transcript NameFunction/comments
g4596.t1hypothetical protein
g4597.t1hypothetical protein

Sequence
5067 bases(100 bases per row)
CTCTCACAGCTTTCGGTATGATACGGTAGTCGCCTTGGTGCTCAAGTCTTTGCCAAAACTCAAGTACTGATTCATTTGGTGTGTAGTCCTCTTTTCGTGC
AATGTCGACAGGATCTTCCAGCCATCGATCAAGTTCCTCTTCTGCGCGTCGATCCTGCCGGCTAAAGGTTGGTGGTCGGCTTGATCTCGGCGCAAATTCT
GCTTCCAGTCGACTGACTTGCACAACAGGTGCAGGTGGTTCAAATTCAGAGACGTCCGCGGGTTCACTTACTGCCTTAAGTAAGTCCAATAAGTTGCAGC
GGATTTTGGCGTTCACATCATTCTTCCTGGTCACAGCATCCCTTCCGCTTTTGCCATGCTGACGGCACGACAAAATCACTGCACGATCGAGGCTCCTCTC
CGTTCGTTTGAAGATAGGGTGGAGTTTCAACTGCATTTCAAATACAAATTGACACTTGTGGAATTGCTTGTCGTTGTAATATCTGCTGAAGAAGCGTTCG
TCCAATGCTCTCCGCAATAGTCTCCGTACATCCGCAGCCAGTGGTGTAAGGTCACTTGCAGGAATCCAACGAGGATTTTTGTCGGTTGATAGGTAGTGTG
GCAAAGGCTGATCAGGGTCGAGGTCGTGAATACGCATCATATACAACTGTACGAGCACGTCGACTTGAACAGGATGCTCTGCTTGACATGTTCGCTTGAT
CTCACCGATTTGCTTCAGCACAGACAACACATGAACCAAGTCGTCATGGCGATTAGCCAACGGGAACTCTGGTGGTGGCTGGTTGGCACGAAGTGCTTTA
CGAGCTCGCTCTTCATACCACGCAGTTATTGCTGGCCACTTCTCAAGAACTCTCTCCAATGAACGCGTCATGCTCAGGAAACGTGAAGTAGAATATCCAA
CAAGTCGCGTGGAGGCACCCTGAGTCTTAGACTTACAGAGCTCTGCAAATAAGCTCCCAGTGACAGACACGACCTTGACCTGAAATATTGTTCTTACCAT
CCGTGAGATTAAGTCCGCCATCTCCGGGTTAGCTGCAGCACTAGCAGCTCCATTTACACCACATGATGACTTTGTAGCTGCGTGGGCCATGTGTGCGAAG
CACCACTCCCAGTGCAGATTGAGTTCTTTGCACAGCATCGATTTCACGTCACCCCCGAGTCGCTCGTAGCCCCGTAGAAATCGCTCGTCGCTAAGCCAAA
GTCCTCGAGCATGTGCTTCAACCACCCTTTGAAGGGCTTGACAATGCCGCCATCACGATCTCCATATGCGGGGTTGAACTTTCTCGTTCCCAAGAGAATG
GACTTGTACTCCCAGGCCTTGTCCACCAGGTAAACCCGCAACCCAAGAAATTTGTCTTGCGTTGTTTTGCAAGTCCAAAAATCTGCCACGAGCGTAAAGT
TCGGGTAGTCCTCTCGGTTCTCTTGGAGGTAGTTAGTGATCTCCTTGCGTGTTGAAGAATACAGCTCCACGATAGATTCCTTCACCTGCTTTGTAGTTAT
CTTGGCCTTCATCTCGTCCTTATAGAGTAGCGCTTGGATTAGTCTTGCCTCTTCGTACTCCACCATACGAAACGTCAAGTTATGGTTGATGATCATGAGA
GTGGTCATCAGCACGTTTAGCCGGGTTGGGTTGTTTGAGTACAGGGCGGACGATGACAGGTGGTTGTAATCATGGTCGTGTTTGCGCTTCTTGACGGTCG
CTATCTTTGTTTTCGGCGAGCCAACGTTGTGTATCTTCTGGAGGTGCTTCACGGCCATGGTCGTTTTGCCAGCATAGAGCTTGAACAGGTTTTTTCCTGA
CGTCCGACACGCCTCGTCGGCCAAACAAGCCCACGCGAAGACCTCCTTCTCGTTCTCGATGTACTTGACACGAACCCCCCACTTGAATATGTACGAAGTC
TCCTTTGGTCGTGGAGGCACCAACTCGAAGGGTCCAAGGGCCTGGAACTCTTTCACTGCTTGGAGGACCACAGAAGGTGGCTCTGTCATCGTCACGCGTT
GGCTGGAGGTGTCGTGGGTCCCTGCAGATGTCACGAGTGTGAAGTAAGTCCCCGATGCGGTCTCTAGTCTTGTCGGCTGCGCTGTGAGCTCGATGCTTGG
CGGCGGAGCCTCTGACCTGAAGTCCGAGGACTAAAGCTGAGGCTGGAGGCACAGTGAGTCCCTGCGGTGGCCACGAGTGTGGGTCACAGGTGGATTTAGT
CCATGTACTGCTGCTTCAGGCGGAGTCCTCTGACCTTCTCCTGAAGTCCTTGACTTGATCCGTGTGCTGGAAGGTGCCGTGGTCCGTGTGGTGGTCACGA
GCATAGACTTGCGGTGCTCAGGGTCCCTGGTGTGATCACGAGTCTGTCGGCTGCACTTCGAGCGCGTCGGAGGCTCAGCACATGCGAACGCAGGCCGCTT
CTTGGGCAGAGGATATCTTCGCGAGTGAGCTCGATAAATTTCAGTGCGGCTGTGGAAGATCGTGCGATTTTCAGCCAATCCAACGCGTAGGATACGAACA
CGCCAGATCCGCATAAATACGAAATGCGCGAGAACGAATATCGGGAGGGAAGCTCGCAAAAATGTTCGTTGTTCTCGCACTTTAGCGAGGAGAACACGAA
AATCACGTTTTTCATGTTCCCTCTTTTTCGTGGAAGCGTTTTTCACCTTTTTTTTTGTTCCCCTACCCGCATGTTCGTCCAAGGCTTGCAAAAAACCGTC
ACGCCGGACTTGTGGCCAGTCGCACCTCATCATTTAAGTGCTCGACTTTTCAGTGTCCGCCACAAGATTTGAGAACAAGCCGAAAACGTTGCGTTGGCAT
GGTTGCACACGCCAGTCTGGCCTCTTTCGACCGATCTGTCGCATATATCAACGTGTAGTCTTGTCAAGTTGCGGCGTTGGATTCTTTTTTTTTTTGTCGT
CGTAGGTAAATACTCGTGGCGTATTAACCTGGACCTCTTTTCGACTTAATGGCGCGTGCCTCAGGTGAAACTCAACTAACTTCAATTTACCGCGGGGTAC
AGAAGAAAGGCTCAACTCGGAGCTGAACGACATTACGAGCCAAAAATTCCTGCAAGTATGCTGCAACTGAGGAGGCTCACGCACAATGAAACGAAAAAGA
TACGACCCGAAACACACAATCGATAGCTTGAAGTCTGCGCCTGTGGGGCACGTCTCACTCGGCATTTTGCCAGATTCAGCACAAGAAGCACTACACCCGC
CAAGACGGATGACATTCGACCACTCCGTCATTCCCCTTCATGAAGAAATTCGGGACCCACTAGCAACTTCGACTTCCAACGAAACTGAGAGCACGGTGGA
TGACCGATATCTTCCACTCAAGACAAGCAAGTCTAACGACTTATGCAACCAAGAAGAGCCGCTAAGAAAGCCTCTTGACTACAAAGAAAACCCACTCAAT
ACTGCTGGTTTTCTTTCGATTGCAACGATGTGGTGGATGCATCCACTCCTGAGGCGCGGATACCAGGCACCATTGGATGAGGACACTGTTTGGGACCTCC
CTACGGCTGATCAAGCACGCCAACTCCAAGAAAAGTTTAACGTATCGTTCGCTGCAGAATCGCAAAAAGTCGAGGGACAAACAATAGCGAATCCAAAGCG
ACCGAATGTGAACCGAGCGATTTGGGAGAGCGTCAAACAAACCTGGGGGGTTGCATTTGCGTTGCACCTGATAAGCGCAGGCCTCATGCTCTTCCAACCG
TTCTTGATCAAGGCCATTCTCAAGAACATCAAAGGCGAAGACAATTTTCTTGGAATCTCTTCGGGATACGTACTGGCTGTACTTCTTGGTGTTGCAGCTT
TCTGCAGTGCTACGACCATTAGTGCAGGACAGTTTTTGACAACTCGGGTGGCTTGCAACGCCCGCATGATTGTTGTCAATAGCGCATTCCGCAAGATTCT
TCGGCTGTCGGCTACCGCTCGACGAACGATGGATACGGGAGAAATCGTCACCTTCGTGGGAGTTGACAGTGATCGAGTTGTGTCAGCTTACAAGCTTGGG
ATGTGGTGCATCGTGGCGCCACTGATGTTGATCGCTGTGAGCGTCCTGATTGGAACGCAGATGGGGATTTCTGTCGCTCTGGCTGCTGCAGCGGCAAAAG
TGATGACCATATACGGAGCTCTCGCGATGTCCAAGCAGATCGGACTCTACCGCCGCCAAATTTCCCGCATTGGTGCAAACCGACTGAAGCTGACGAACGA
GATGTTGCAAGGCATTCGAGTGGTCAAGTTCTACGGATGGGAAGACTTTGCCAACGAGTTGATTCACGAAATTCGCCAGAAAGAGATCGGTCTGCTGCGC
AAGTACAATCGTCTGCGCCTCGCTAACACGGTATTGATGTTCTTGGCACCAACACTACTCAACTTGGTCTGCTTTACTACCACAATTGCGCTGGGCAATA
GCTTGGACGTGGCGACGACGTTTGTTATCCTGGCACTCACCAATGCATGCCGTACACCCTTCAGTATTTTTGCGGATGCATCGATGGCCGTAGCAGAGGC
GATCACATCCACCAGTCGGCTGTCAGATTTTCTCGCTGCGGGGGAGAGCTCTCAGGATATCAAGCTAGACACTAATCGAGGTGCGTTACCGTTAATCTCG
ATCGAAAATGGCGACTTCCGATGGGAAGACGAAGCCACTGCGCCGACACTCTCGAATATCAACCTCACGCTCCAACCTGGTACTCTTACTGTGGTCGTGG
GGGCTGTTGGTAGCGGTAAAACTAGCCTCGTCAATGCAATTCTCGGCGAGATGCAGCAAGTTCGCGGGACGCGTGTGGTTCGTGGAGACATCGCATACGC
GAGCCAACAAGCGTGGATCCAGCACCAAACAGTGCGCGAAAATATTCTCTTTGGTGAACCTTACGATGAAGAGCACTATCGCCAAGTGATCGCAGCGTGC
CAACTAGCCCCAGATTTTGCGATGTTGGAGCAGGGTGACCAGACAGAGATTGGCGAACGCGGCATTAACCTTAGTGGAGGCCAGAAGGCTCGGGTTAGCG
TGGCTCGGGCAATGTATCGTGCTCACAAGTTCGATTTTGTTGTTCTGGATGATCCGCTGAGTGCCCT