Description :
From Genome Similarity Track
Location :
Scaffold_940:15340- 17027
Transcript NameFunction/comments
Phypl_g11748hypothetical protein

Sequence
1687 bases(100 bases per row)
GCGGCCTCGTGGATGGAGCCGTCCATGCCCATGCCACCGATGCCCGGtctgcgttgctgctggtccgcCGCCATGCACGTCGCagaggagctgctcgctt
cGACCTGCCGCTTTGTGTTATGAGTTCGGGTTGACTGATTGAGCTGGACTGGTACACGGTACCGGCGGTTGCCGCGTTATCTTCTGACGACGTAATCACA
CCAAGGGACGACTGGATTGGACGAAATCGTCGACTATGTGGACCACAACGCGATTCTGATTGGCTGAGGACAGTGGGACGGAATCGGATTGGAGGGaaag
cgcgtggtggacaGAGAGTGGTACGGTCGCTGAGACTTATAATCCGTGGTACATATATATGTGCACAACGCATAGACGGGACAGTATCCATTAACATGGA
GGACCCAAATTGTTGCTTACACAGTCTGTGCAACACAGAACTCTTGAGTCCTGGTAATCGGACTAATGACAGGAGGCCTCGCACTTAGCACCAGGAACAA
ACCTCTAGCGCTCGGTAGCAGGGCCGTGATTAAGAGACACCATCAGAAATGGCTGCTGCCAGGTTCGAAAGACCCCTTTACTTCCATTCGCTTATAGCGA
AGCGTTGCGCTTTGGGTCCGCAGGACGTGGTTTTCGGTGTCACCAGGATCCTGAACACCCGCCATTTACATGTTAAAAATTACCAACGAGTGGCAAGATC
TCCCCAGAGttgcacagcagcaagccacTACTCTCACTCGTGAAGCTGACGCTCGTGAGAATACAGTGTCGGTACGATCTGACCTACCGTTGTTGTCGAA
TATGCTTGCAAAGCAAATTCAGACAGCGAATGATATGCATAATTCCACTCAAGTAAAGAATGCCGTCAAGTAGTCGGCGATGTGACCTCATAGTATGTAT
CAGAGGTCCGAAAATTCAGTTCTGTATTGAACTGGAAGTCCCTCCTTGCTGCAATAAAAATTCCAATCTACGAGTGAGCAATAATAAAAACTCCCGCAAT
TCAGGTTGTATTGCTGTTATCTAGCTACGTCTCGCGCTTCTACCGTTCGCTCGTAGCCCGGTGGCAACTCCTGTGCGGATGTTCTGTCGATAGTCGACTG
GCCAAGAAACCCCAAGCTCTCGACTGTTGAAAGCAGCTAACATATCTTGAGGTAAGTCCCGTGCAGGCTGCCACGTTAGCCGATGGTAGCCTACCCAGCT
CACAAGATAGAaatcttctccagcttcgttTGTTTCCTAGCATACAGTGTATCTGCAATATATAAATCCAGTTCACCCTCAAAGTCCGAGCTCTCGTCTT
CTGGGTACGTTTCGTCCTCCAAAATCTGCAGCGAggggcagcaccatggcggCGTGCGGGCTTCCTCTTCAAGCTCCACCAGAGTTGCAGGTCTCAGTTC
TGCTGTAACAGCGGGCTTGTTTTGCCTTTTTTTCTGGTGCTTCGCTTCTGCTATTGCTTCGAGTTGATTGCTTCTTTTCGTCTTGCGCGGCATTTCTAGC
AAATGTAAAAATGCCATCGCTGATCGAAAGCAGCGAGATAAGTAAACATAGTCTCTATTTTTACCAATATGCAAACCAAGAGCTACCACTACGCTTTAAA
TAGTGTAATTTGCGGTGATTATTTTGGCGATCTATCTTTACCGGAGAATATCACACAACAACAATGTGGTCATTTATATTTACCGTG