Description :
From Genome Similarity Track
Location :
scaffold_60:153368- 161608
Transcript NameFunction/comments
g6712.t1hypothetical protein
g6713.t1 hypothetical protein PHYSODRAFT_466642
g6714.t1hypothetical protein

Sequence
8240 bases(100 bases per row)
TCTGCGCGAACAGAGCCGAGCATTCCATTAGCTCGATCTTCAAAGGACGTAATCGCGCTGATCATGCTGCGCTGGACGTCGCAGCGCCCGCGTCCACGAG
GACGCTGAAGCCTCATTTCTTGCAGCGGGTCGACGGCAGTGCCGCAGACAGCACACACTGCGTGAGGTGGTCGGTCCAACTGCACTGACGAATTCCAGTG
CAACGTGCTTCATGTCGGCCCACTGCTGCGTGCAGCTCGGACAGTGCGTGCGCTGCTGGTGCCCTCGAATCTTCTGCAGCATTTGGTCGCCAGCGGCGCG
AACCATTCGTTCCATCTCGGCTTTGTCCTGTCTCGCCGCGGTAGACTGCGCATAGCTGCTGGTTGCTGTCCGTAGTTGAACAAGACAAGCAGCGAAACGT
TAGTGACCGATATCCAGTGCAAGGCTGCACAGCACAGGAGACGGAATCCGGTGTACCGATGCGTTGCCACTTCTTGAGTTCTGCGACTGCACTGTCCAAG
TCGCGCCGGATATGCTGCATTTGCTGCGTGGTCTGCTCGAGTTGCTGCTGTCGACGCACCAAATCGTTCTGTAGGCGAAACGAACGATTTGAAGTCATGT
GTTGGATTTGGTAGGCACGCTCTAGCTCACATCGCATTTCTCTCAGTCGCTCTGGAATTCGCGAGGCAGTAGTTGTCTGCTGCTCGTTGCGGTTGGAATT
AGGGCGAGTCCGAGGTATGACTTCATGATCAACCACTGCACCTCCAGACGAAAAGTACAGACGCACTATTTTCTTAGCTCCGCGCCGGCAAACAGGACAA
ACTCGTTTGCTTGCTAGAGCTTGTTCCGCACACGTGTGATGAAAAACATGGCCGCAAGCCAATGCTGCCAAGTGTATCTGCAAGCTTTCTAGGCATATAG
CACACTCGGTGGACGCTTGATCTCTTTCTCCGTTCTCGCTCTTGGGCATTGGTGGGGGTGATCTTTGTTGCTCGTACGAAGATGGTGAGCCAGGAAGTCG
ATACGACATGCTTTGTGAATGGGAACTTCTGAGTGGTCTCATTCCTTGCCAGCGCTTCGATGGGAGTAGACGCAAGAATACAGCAACGTAGCTTGCGTCG
TGTCCCTGTTGGGCTTCTTCAACGAACATCTTTCAAATGGCGATACTAGTATTGTACTTTTTTGAGTTCTATGTATACTATCTCTGCGTTCAGGCTGCAG
TAACAGGTCTGCCTAGATATGCAGCATAGCTGCGATGTAGGACGCGCTGGGGCGTAGTGACGGATCGTATTGCAAGCATGCGACTGCCAGCTCTCGGACC
ATCGTGGGACATTCAGGTGTGAACGTGAACATGCCCATAAAACTCGTGTCATCGTTGTTGTGTGCGCCGAGCAGAGGAGTGGTCCGTCGGCGGTTTTCCT
CCAGCCCAACACTGCGCGAGCTTTGCAGCGTACGCGAGCTGTTAGAGCTTGGCAGGCTCTCCAGCTGGGTGGTACGTCGTCGTGAGCTGTCCGAGTCACT
GCCAATGTTAGTTGATACAACCGTGCCGTCCGTAGAGAGGAGAGTGCCGTTGTCCGTGTCGAAGTCACCAATGTGCGTACGCATCCTCCACGAACTTCTG
ATCATTTCGTCTGCTGTCTGGCAAGTGTCCAGGTGTGCAAGCAGCACGCCGAACGCGTACATGTCCGAGGACGACCGAGACGGCTCGCCGATGAGGATTT
CAGGAGCGAAGAACGCCTTCATGGTGGAATCGCAGCTTTGATAGAATGACTGACAACTGTAGGGGGATGATCCATCAGTGGGAAGAGCAGCCTGCACCGG
GTTTAACTTGCAGCCCTTTTTAGGGTCTACAAACACGCTTCGGCCATTGAGCCCGTCGTACGTAACCATGTGCTGGCTGTGCAGGTACATGAGGCCACGC
GCGATCTCGGATGCTGCTTTCATCTTGAAGTTCTTCCAGTTCAGCTCTGAACCAGAACTCCTCAGGTATGCTTCAAGCGTTCCAAGCGTCATGTACTCGC
AAACTGCTGTCATCGCATGTCTTTCGTCCCACACCAGTCCAGTGATCGAAAGCAATTGCGGGTGACGCATTTGCGAGAGTGTTGGCACCATGTCTAAGGC
CGCCTCCACATCGTCATCGCTGGTCTGGAGTTTAGTCACAAGAACCAAACGCGTGCAGTGTTCGGCAAGCGCAACGGTAATAGGGCCCGACATTGACAAC
TGATTCAACATGACGACATCGGTGGACAGGATCTCCTTGAACGCCGCCTTGCGTAGTCCACCACCGGTGTGGAACTCATTAAGTGAAGCCTCAAGCTCAG
TGGTCTGCATAGTGCTATTTGATAGCACACCCATCCGAGATCGAAGGCTCCGCAAATTCGACTTGATCTTGCTATCACCAGATACCAGCGAATCGTGCTG
CTGCAGTGCTGTCTTTTGTTTATACTTTCGCAGGAAAACAACACCTCCGACCACGGCCAACACCACGAAAAGCGCAAGCCCCAGAACGACGAACAGAACA
GCGGAGCTATCTTTGCTCTCGGTTGCAGTGGATGTTGTACTTTCCTCTTCGGAACCGGAGCTGTTGATACTGCCGAGACCGTCACCATTTGTGTAGCACA
CGCTTTTGTCCGCCCAGGATACGGCTTCATAACCAGTGGAACAGCTTCCGGTGACTGTCAAATTGGCTTCAAACACGGGCAGATCCTGCAAATATTGAAG
CTGTGGGTGGGTGACGTGGGCGTCCGTGATAGCGTTGCCTTGTAGATATAAAGCTGACAGGTTGCGCATTTCATAAATAATGGTTGGGATATCCGACAGC
TCGTTGTCACGAAGGTCTCTGTAGAAACAAAGGCTGTCGTTAGTATACCATCCCACATCTCATTATGAAACCGCACGTACAAGGTTGACACAGACGTGAA
CGCATGCTCGCCACGTGGATCAAATTGAGTGAGCTTTGACCGCTGAATAATACTGTGCATGAAACGAGATAAACTCCAGTCAGTTGACGCTGGCTGGGTA
GCCGAATGCGGGTGTGTAAATATCAACATACAGAGACTGAAGACTGTCCGGGAAGACGTTTGTGAGAATTTCATCGATATGAACATCAGAAATGGTTCTG
TAGGAATAACAACACAAAGACTGTCAGTACAAAAGTTCATCCAGATAGCGTATCAATCGCAGCTAAGCACACACATTTGCTGCAGCGCAGTGCCACTCCG
GAAAGCGTCCGACGAAAAAGAGAGCGGGACTGCGATCTGCGAGTTTGTCGTCGCGGTCACGATTGTCCTACAAATTACAACAAGACACCGGAAAATCAAC
GTTAGCAAATACGGCACGCATTCTTTCCAGGGAGCAATCGCCACGTACAAATTCTGCAAGCTCGACGGCAGCTCGAGGTCGTCGATGGCTTGAAACACGG
CCGTGTTGGCCTTGTCGCTTTGTGGCTGGGCGATCGTCAGCGTCCACTGCGGCATGCTCCAGCTTTCTGGCGTGTCCACCAGACACTGCACCTCACACTT
GCCAGACGTGACGTCCGTCTTGCACGTGGGCATGTTGGCATACGCACAGCCCCGGTAGAAAAAGTTTCCGTCATTGTTGTTGTTCTCCTTGCTCCTGTCC
CCAGTTGTCGACGCGTAGTTGACACAGAGCGAAGAGCTGCAGGCTCCGTAGCAGTTGCTCGTGAGCGTGTTGCTCTCCGGAGGGGCACAGGCCTCGTCCG
CTGCAGCGACTGCCACGGCCAGAGCTGCTGCAAACGCTCGGACGCTCCACATTTCTCGCTTGATTCTGCTGGCTTCGCTAGAAAAACACTGGACGCTTGC
TCCCAAGCGAACGCTGCGGCTGCTGAGCCCTCGGACCTGGAATGGGCAAGGCACACACGAGTGTTGCGCGACAGCAACTGGCACGAACTCCACAGGACAA
ATGGTGCTGTGAGTCGCTCCACGGAAATGTCTCACTGAATTGTGCATAGCCAGGAGGTAAAGCCAGTCGGATTTCACCTGTTCAATTGGTCAAAAAGCGG
GTCTGATAATTGTTCTGGTTGGTGGAAAAAGGGAAACCCCGTAACGGCGATTTTGACTTGGGTTTACTATGGCGATCGTTTTTCGCCGTTTTTCGATGGT
GGTCGAAATTCAACGTTCACCTTTCCACCTTTTCTTGCTGGTTGTTCCTGGTGTTGATGGGGACGTCGAGTGCATGCTGGGCGCTGTCTCTAGTTGCTCA
ATTGAAGATGCCGCGATCGATCTTTGAGTAGAGTCGATACTCTTTCGTGCGGTTGAACTCGCAGTCGTTACCACGGGCCTTTCCGAAAGACCTTTCGTGG
CCGCAGGGTGAACACGACCACGCCAAGTAATTGTTGCTGCTGCTCGCCGCAGCGCAGCCTCACTGCAGCAGGCCAAAGTGCGACTGTATGTGCATGTACT
AATACCGATGGCATCTCAGCAATATTGGACACACGATCGGATCGAACGTGAAGTCCATTTACACCTGGCTGTGGTCGTGTGGCTGGGAAGCGAGAGGTGC
GTCTGGGCGGTGCGGCTGTCGTCAGGCCTTTTTGACGAAGTTCGAGCAATCGTGGCCGTGACCATCTCGAAGCTGACCAAATGACCACCGTCATTTCGCT
GATTTGGTCGATAGGCGTGACATGTATCTGTACAATCGCATGCTCGTGGATCGCCCCCAAAGTACATAAAAAAAAAAGCAACCAATACTTCATTCGTACA
CCAACCGAGGCGTGTCCTAATATAGGACGGATTCTACTTCCGGACGGGTTCTATTTTCCAAAACGGTTGTCAACGTGCGTCACCAAGAGCTCAAATTAGA
CGTGCTCCGCTATTTACAACTGCGACAGGTGATCTCCACGCCTGACCGACAGCGACGAGGGGGGAGTGATCAAGCAGTCTGTTCAACGAAGCCGTATTCC
AAACCCCATGAGCGCGCGAAGGTTGCGCGAAGCGACCAAGATTACACCTCGCAGTGCCGTCGGTGCGCCGCTGCCTTGCTATATTGCCACCAAATCCTCA
GTCCATCTGAATAATACATTCTCTTGATGTGCAGGTACCCCGCACAAAGCTGCTGAAACTGAGCACGAGTATTTGCGACGATGTGTGGACCCGGTCCTGA
TGCCCCTTATCGAGTCGTTGCTGCTGTATCAGCCGGAGAGCGTCTTCCACTTCATCCTCGACTTTGTGGACGAGCAGAAGGCCGGTCGCTTTACGCACCA
CCCGCAAAGCGTAGGTTACGCGAAGAAGCTCACAAACCGCCGTAAAATGGTGGATTTCATGTCCACCAGCGTGATCCCCGTCATGGACGATCTAGCCAAA
CAGATTCTCCGCGAGAAGCCAAACTCCGTGAAAGGTGCGTCGTGGCCATTTTTACTACGTACTTGTGTTTGACTTTTAACGCTGACCTGTCCCTCGCGTG
AAGCTTTCATTAAGGACGTGGTTGCTGCGCGTATAGTTATCGAGTCCAGCGAAAGCCCCGAAGAAGCATCAAATCAGCTTGAAGCCCATGTTTACTTCCG
CATAAATGACCGTGTATTATGTCGGTATAAGGGTCGACCACGCTTCTTTCCAGGTATCATCACTGCAACCGATGACAATGGCAGCTTTACAATCTTATAC
GACGACGGAAAGACAGAGAGCAATGTCCACTACATGTGCCTGAGACTGCACCCGACACCGAACTCCAGCGAGACGGCGGCAACACACAAAATGGTTGATG
GAGAAGTTGAGGACAATCAGGAAAAGCCGAAGGCCAGTCGCAAAATGGAGATTGTGCTTTTGATAATTGGTATCGACGGAGCTGGGAAGACTACGCTCCT
TTCCACGTTGCAGGGTGATCTCGACAAGGAGCATGTGCCCAGTGCAGGCTTCACGTCTGCCAAATTTCAGACTGAGACAGGATCTGCTACATTCTACGAC
CTCGGAGGCGGCCCAGCGTTCCGCAACGTCTGGAAAGAATACTACGCTGACGTACGCAACTTGGATGTTGATGTCCTAAATTGATATTAACTGTCACATG
TTGCGTCTTGCCCAGGCTCACGGCATCGTTTTTGTAGTCGACTCGTCAAGCGAAAATTCAGTGCTCCAGGCTGCTAATGTGCTCGAAGAATCGATGGCGA
ACGATCTCATGACCAACAAACCTTTGCTAATGTACGTGCAGCTCTGGGCTCAATGAAAGGCTACGTAATCCCATGCATTAATGAACAACTTGCGTGCATC
ATACAGCTTTGCCAACAAACGCGACCACTCCAACGCCGTAGGAGAGCAGGAGATGCAACGTTTACTGCATCTGAACAAGTTTCCCGGCTCTAAGATTGTA
CCCTGCGTTACCAAGCCAGCCGTCAACGGTGGAGCGGTAGACGAGCGCTTGGAGACCGGTCTTGAGTGGCTCTTTGAACAAGTTCACAATGACTTTGACA
CACTACACGAACGGGTTCAGCGCGATCTAGCACTAAAGAAAAAGCAAGACCAGCAACGGCGAGAGGAGCAACGGGCTCGAGTTTCGCGTTGGAAAGAAGA
GCGTGAACTTAACCAAATGCGTACTTTTGACAAGCCGTCCATAGAGGAGCAAACCCCATCGTCGTCGAAAGCTGCAGCGGATAGACCGGAAGAGTCCGTG
ATATACTGCTCAAACTGCAGTACAGCGCCAGCAGTAACGAAGTGTGCTGCATCTAAGTGGATGCCTGTATGCGAAGACTGTGCAACAGCTTTGAGAAGTC
AGTCCACATAAGGTTGAATCAAGAGATGCTACACCGCAAAAGCAGCGATTTTGGATTTCAAAGGAGCTCTCTATTCTCTATCTCATCCTCTGCGCTTCTT
GCCACCCTTCTTACCGCGACCTCGCTGCCGCTCTTCGTCTTCTTCTTCCTGTTCTTTCTTTGAGCGCGCGCTGTTCATGATCTTCTCTACATTCTCCTTC
TTCTTGCTTTTTCGCATCTCCTTGCGCTCCCGGCGCTTCTCGGCTGCCTTTTGCTCCTTTTCAAGACGCACACGCTCAGCCTCTTCCTTCTTACGAGCGG
CTTCACTATCCGCTTCCTGCTGCTCAGCATCAGCACTATTGTCATCATCTTCCGCAGGTGGCTGAGCAGGAACGTCATTTGCATTGTCAACCTCGCGCTT
CACCTTACCGAGCGCGATAAGCTCCTCCTGCAATACTCGATCCATTTCATCGTCCAAAAGGCTGAGGTCACTAAATACACCAAGTTCCTCCTCTTTCTCG
CGGTGTTTCTTCGACGTGAGGTGGTTCTGCAACTGCTTTGTAGACTTGAAGGTCTTGCTGCACAGGTCACACACAAGAACATCCGCGTCCATTTTCTTTC
GGAGCTTCTCAAGTTCCTGCTCAATGTCTCTGTCGGCAACACGGCTGGTCTCCATACCGCTGTCGGCCCACATCTTCTCCTGCTGCTTCTGAAACGCGCG
TCGCTCGGTGTCATACGCCGCTTGTTTCTCGCGCTTCTTCGCCTCTTCCTCAATACGCCGCTGCTGCTTCTCCTGCTCCTTTTGCTTCTGAAACGCTCGC
ACACGCGGGTCGCGACGGCACACGAAATCCACAAGCTCTCGCACTTCAGTAGTAAATGCCTTCTTGGCCACATCCCGCAGCTTTTTATTCTCCTTCTCCA
TGGCCCGCCTCACCAGTCTCGTGGGTGCATCGGTCGTTTTGTACTCATCCACCCACGCAAAGCTGCGCTGTGTCGTGTAGCTCTTCCAGTGCTGGTAGAA
GTAGTTCACGTCGTCCATCGACGTCTCAGCGCCTCCGATCTTTGGAGCAGCTGCGGATCTGGAGCCGTCACCTCCCTCCACGTCCAGCTCATCAATCTGT
CTCCAGCAGCATAAACTCCCAAATTAGCGTCAAGAACTCGCAAAAATGCTGCACATAATAGCCCAATGCACCTTGGTGAAGAGGTCTCCGTACACGACGT
AGAAGCTCTTTGCGTCCGAGCCAAAGCCCGAATACACCGACGCGCTGAAGTACCGGAACAAGTTGAGCTCGTCCTCGTCTTCGTCCTCATCGTTGCCATC
TCCGCCGCGCAGAATCTGCTCGCGGTGCTCGTCGTACCATTTCTTCTCGTGCGGGTCGCTCAGCACCTCGTACGCGTTCTGGATGGTCTGGAATTGCTCT
GTGGCCTCCTCGCTTGAGATGCCATTCCGCTGGTGCTTGTCCGGGTGCCACCGCAGCGCCTGCAGACGAAACGCCTTCTTGATCTCCACCGCCGACGCAT
CGCGCGCGACCGCCAGCACCTCGTAGTGACAGCGCATTGC