Description :
From Genome Similarity Track
Location :
Scaffold_43:153361- 155296
Transcript NameFunction/comments
Phypa_INRA-310PPTG_14440GPN-loop GTPase

Sequence
1935 bases(100 bases per row)
AGAAGAGCTAGAAGAAGAAGAAGAGTAGTTTGATCTTGTCGTCAAAAGACGAAGTGAGCTTTCATTGGACTTAAGAAACCACAGTAGCTGTAAACCAGCC
ATTGGAGTTAGTATAATCAAAACTAGTCATAACGGCTTGAAGAGGGCCTACTAGATCTGATTATAATCTCTTAGAGAGATTTGTTAAAGTAACCATAATG
TTTAGAGGCCACTTCAACACACTTGAGGACACAAAAAATGATCAACATCAATCCAGAGGACATCACTGCAACAATTGACTGTGAACGCAAAGCACATGAC
ATGTTACTGATACATTTTGCGCACCGCCGTTTGAACGACGGTCGCCTCGGCGTTGTCTGACAGGCTGTCACAGCTTCAATGAAGCTCGTGGTCTACCTTC
TCCATTACCAGCGATGAAGAGCTCACCAAGCGCGAGTTCAAACAGACCTGATTGCCGAGGATTTTTATCCCTACGCTGCGAGGGAACCGCGTCGTGAAGA
CCCGAGGTTGTTGCTACTATCCTTGCGTTCAATCTCGTCCCAGGAGCAGCCAACAACTCGGTCCATGAACGCGTCCGACCACTTGCGGTTGCCACCGGGC
GAGTTCTCCTTGCCCTGCTTGGCTCGCTCGTCGAAGACACTGCTGCAGGTCTTGCACACGCGCTTCAGGTTGGACCGCTCGTCCGATGCATTGCGGTCGA
TGTGGCCTATAAACGTGGGTGGGAATGCCTCACTCTCGACCGAGACATGCGAGCAGCGACCGCAGATGAGGCGTCCGCAGTGGCGGCAGTGGTGACGGCG
CACGCCAACTCCGAGACGACTGAAGTTTCGTAGACAGATCATGCAGCCCTTGCGCTCCATGTTGGGGACCCACACGGGCGGGTACGAGATCTTGCCGCAG
AGCTGGCGCAGCACCTTGCGGTCGACCTTCTCGAAGACCATTTGACCCTGTGCATCCTTCGCATCCAAACGACCTCCGTGGCGCACCAGTCGGTAGGCGA
TCTCGAACAAATTGAGATCCACAGCCTTGTGAAGTAGCGTGCTGTTGCCGAGCGGGCCGTTCGGGTCCGACTTGTGCTGGAGTAGCATCTCAGTAATCAG
TGGATCATCGCGCTTAGTCGTGACGATGTGCACGGCCAGGGGCGTCTGATTCCGGTTGTTCACTCGTGAAGCATCGGCGCCGTGCTCCAGCAGGTACTTT
GTGATACGGCGCGACTTGGCCGCGGCCAAGTGTAACGGGGTGTTCTGTCGGTTGTCCACAGCATCAATCAGCAGGCCGCGTGTCTTTTTGCCGCACAACA
ACTGCACGGCGTGCAGCTGGCCGAAGCGCACAGCAATGTGCATCGCCGACTGGCCGTGCACCGGATCACGCTCTGTGAAGTCCGTGTTCCTGTCTTGCAA
GCAGGTGCGTAGGAGCTGAAGGTTGCCTGACTTGACAGCGCGAAGGTAGTCAGAAAGACCTTCTTCCGTCACGCGTGGACCGAAGTGCATGACGGAGCCA
CGTCCACTCATGAGATCCGTACTGCGGGTGCTCGCGAACGGGTCGACGCCGCGACTGCTGTCGAATAAATTGCTGCTTCGACTGCTACCGAACTGATCGT
TGCTTCTGGAGCTCTCGAGCCCCATGTTGCTACTGCGACTGCTAGCGTACATGTCGACACTGCGACTGCTTTCGAAATTCTCCGGGGCTAAGCTATCACG
CAACACCATGGCTGTCGTGAGGTCCTGAGGCTTGAGATCACTCGGACGATAGCGCATCATACTGTCACGGTAGCCACTGTTACTGCCACCGACCGCGTGA
GACGCGTCTGCGGACTTCTTCTCTACCGACAAGCGGTCGATCTCCGAGTTGCCACGTGAGTTGCGAGGCACTCCCAGATTGACCATCTTGTTGTTATCGG
CAGGGTTCGCGGGCGCCTGGTTCATGGGCATGCTC