Description :
From Genome Similarity Track
Location :
Scaffold_3:153331- 154632
Transcript NameFunction/comments
Sapdi_VS20SDRG_01152hypothetical protein
Sapdi_VS20SDRG_01153hypothetical protein

Sequence
1301 bases(100 bases per row)
TGAGCTGGAGGTAGTCGTACACCTTGTAGTCGTGCTGGTAATAGACTGCGGCGTTCGTCGGCATCGGCGCCTGAAACCACACGCTCGCGCAGTGCTCACT
TGCGCAGTACGTGCGCATGCGACTCGTGTCGTCCGACTCGAGCGTAACGGCGACGTCATCGAGATTAGCGTCGGACGACGAGTCCATTGCTCCCGCTCGT
TGGCCTTTTTCAAAGTGCGAAAGGCAGCGACGTTCTTGCGGTTGGTGGTGGCAATGGCGGCCACCGACAGCAACATGGACCCAAGGACGTTTCGCGACGC
CCCATCTTGGCCCCACGGATGCTCGCATTCACCGAGTCGAATGAGACTACAGGGCGATAGTCTATCTACAGCTGCGGCAATCCTACAGGCCAACCTTCGT
TGCTTGTGATGCCATATTGATCAAGCCCCGAGTCCTCGTGCTAGCTTCTGCATGAAACAGCTCATTTGGCGTCATCAGTTCGGATTTCTCGAGTGTAGAT
GCTTTACGAGAGAGCGAGACGCGGGATCGATACGAGGCGAGTGCATCGCGTCATGAGAGCCAAAGTTAGTGCAATATCAACATGGTATGAGCGAAGGCTT
AGTACGGTGTAGGCTACCCGCTGTGCTTGTACGGGACGAGGAGGCAGCCGAGGACGCCATTGCCGAGCCATTGGTGCGGCGTGAGCTGGAGGCGGAAGCG
GTCGCTGTCGTTGCGCTCGACAACAACCTCGATCGGCATGTTCATGTTGCGGAGCACAATGTCGCGCACGGCAGCGAGGTCGCGGTGGTTGGTGGCGTTG
GCACTCCCGAACGCAATGATGCTATCGTAGGCCTCGAGGCCCGCTTCGCTTGCGGGCGAGTCTAGTCACGCCGTGAGAAGACCTAGGCATGTATGTGCAA
GCAACGCACCAGGCTGGACCGAGTCGACAAGCGCGAACGGCGCCATCTCGAGCACTAGATGTTGACCGTAGGACGCTGTTTATCGCAGTCGAGACGTACC
GACAGGGTCGTCAACCTTGACAAGCAGAGGCGCTTCTTTCTCTGGAGTCCGAATGGGCGCGGGAGGCCGCACGGGCGCTTGGGCTGCAGCGGCTTATGAG
GCCGGCAACGATTTCATGGAACTCGTACCTGGGGTCGGGACCGCGGGCTTGCTTGCAGAGTAGATGCTGCGCCACATACCATAAGTTTTGATAGGCTATG
GCGCCGAGCGTACCCGGCCATCACGTCTTCAATGTCCTTCATCACGAACTTGAGGTCGGTCTGGAGGCAGGCGAAGCGGTGGCGCTTGTGGCGAACGGTG
T