Description :
From Genome Similarity Track
Location :
contig_76:153290- 155734
Transcript NameFunction/comments
g12445.t1hypothetical protein

Sequence
2444 bases(100 bases per row)
CGACAAGAAGAAAATGCAGTTGCAACGTTTGCGCGCCAACATCCGAGTACGTTGACCTTACCAAATCTATCAAATACGCATTCGTATTAATCGATGCCGC
TCTTGCTCGCAGAGGGAAATGCGCGAGGAGGACAACTGCAACATGTAGGCGAGTGTAGCATCAATCCGCTGAATGTAGCCATTTATTGTTGATAGTCAGT
GTGCACCACACTAAACCACGTACCATACACCATTTTACGAAACGGAAGCGCCAGACTGCATTCTTGGAAAATCTGAAGAGTCGAGCTGATAGTCACCAAG
TGACGTCGCTGTCTCTCCGTGTCTGTCGCCCCCCACGCCCCAGCTCCCTCCCATCACTAACCTCTTGTTAGCTGAAGCACCAGGCTACTTGTCTCCGTTG
CAAGTGCGCCATAATCCCCCGAATTGACGTCACCAGAGCTGAACGATGGAAGGCCAAGTGGTGGAGCTCACCGAGGCCGAGCAGGCCCAGCACCAGCTGC
AGATGGAGCAGCAGCTCAAGTCTTTCTGGGCAAAGCAGCTACTGGAGATGGAGCAGCTCGAAGTGGGCAGTGAACAAGGTGCCGTGGACCTAAAAAATAG
TTTTTTGTGACGCACGGACACTAACTTTGTGCACGATCTGCGACCTGGTGACAGACTTCAAGAACCACAACGACCTGCCACTCGCGCGCATCAAGCGCAT
CATGAAGTCGGACGAGGACGTTCGCATGATCAGCGCTGAGGCGCCCGTGCTGTTCGCCAAGGCCTGCGAGATGTTCATCCTGGAGCTTACGCTGCGGTCG
TGGGGCTACTCGGAGAAGAACAAGCGGCGGACGCTGCAGAAGGAGGACATCCAGACGGCCATTAGGAACACGGACATCTTCGACTTCTTGGTGGACGTCA
TCAACTAAAGAGGACGCGGTAGACACACACCAAGCTCGACCGAGTCTAGCCAGTAGCTGCCAGAGATGATGTAGAAGAGAGAGTGGGTGGAGACTGGGAG
AGCTGCAATATAGCGCTTGATAGCAATGTCAATGGAGGCTTCATGTGGACACTTCCTTGGTGTCCTCCGTTGTCGCGTGGAGTGGTGCACACCAAAGACC
ACGTCATCTCAACCTTGAAGTACCGGGACAGCGTCATTCTGCTACGCGGACGCTCTCCGCTTCGACAGCGGCGCTATATGCTGCTGTGTAGTACGATCCT
GCCGCTATGGGCCTGGTCGCGAACCTCTACACCTTTTTGGCGGCGGCAATTCAGCTCACAGAGGCAACAGTACCAACTTGGGTGTTGAACCAAGGCAACG
AAGCCCGTCGGCAAAGCCAGACCCGTCACCGTCTACCAGACCAATTCCAGCCATACTTCCTCAGCGCTAGCATGGCATCAAACTCAATTAGTGCAACACA
TCCCACGTACGGCAGGCAGCAAGCAGCTTGCAGTCCTTCAAGTCTTGCGTTTCGTACTTAGCCTAGCACGGTCGCCACGTTCCTAACTTGAAGTTGCGAA
TATCGCGTCAACTGCTTTGCGTCATTCGCCATTATCCGTCCAAGTCCCCCTTAAGCCTCAATGCTGCACACGACCTTCCTCCGCTCCTCGCACGCGCTTC
GCTGCTCCACTGTGCCGGACGTTGTCCACTGTTCGCTCCAAGGACCAGGTGGGCGTCATCGGTCTGGGCCAAATGGGCGGACGCATGGCCGACAACCTCC
GCAAACACGGCCACAAGCTTGTCGTGTGCGACCCCGCGCCCGCCAACGTGCAGAAGCAAGTGGAAAAAGGCGGTGCTGTGGCCGCCTCCACGCCCGCCGA
GGTGGCCGAGCAGTGCGACACCATCATCACCATGCTGCCGTCCACCGCCATCGTCGAGAGCGTTTATCTGGGGGACGAGGGTGTCCACGAGGCGCTGCGC
AGCGAACACTTGCTGCTGGACTCGAGTACCATCGACCCGATCTTCACCAAGAAGCTGAGCACCAAGCTGCACGAGCTGGGGGCAACGTTCGTGGACGCTC
CGGTGTCTGGAGGTGTAGCAGGAGCTCAGAACGGGACGCTGACGTTCATGGTGGGCGGCGAACCGGAAGAGTTCGAGCGTGTCAAGCCGTTGTTGAAGGC
CATGGGCAAGAACTTGGTGTACTGCGGTGGAAGTTGTACGTAGTTGGAGAATATGGTGGCTATAGGAAGTGTGCTGAGTGGGTTGTGCGTTTTGGATTGT
AGCTACGGGGCAGATCGCCAAGCTGTGCAACAACCTGGCATTGGCGATTCAGATGGCGTCGGTTGCTGAAGCGATGAACCTGGGAACGACGCTGGGTATT
GACCCCAAGATCCTCAAGAACATAATGGACACGTCCACGTCTTCGTGCTGGTCTACTCTTGTGTAAGTGGAGTGGGGTATTGTTGCTCAGTCTGGGCCGA
TGCTGACGTTTTGCTGTTTGTACAGTAACCACCCGTACCCAGGT