Description :
From Genome Similarity Track
Location :
Scaffold_112:15326- 16356
Transcript NameFunction/comments
Phyra_84382Hypothetical protein

Sequence
1030 bases(100 bases per row)
TGCTTCCAGCGAAATGGCGGGGCTCAGCGCCGATATGCGTCTGCACTCTGAGCTCAAGGCCCTCTGTCTGCTGGATTGCGGTGTGGCGAGCAGGCGTCGG
GCGCGAAAGAGGCTCTGAGTGAGCATGCCACGACAGACTCGAAGATTGCCTGATCTGATTTCGTCATGGGCATGATCCATAGCAACACGGAAACGAAAAC
ATCGGCGACCAGCCTTCGAGCTTACGCGAGGATGAAGGCCAGGTGCATGCGTTCGGGCGATGATTCAGGTTCGATGGCGATCAATACGTTCGTGTCGCGC
TTGCCTGTTGAAGGGATGCTATCCGTTGCCAGGGGAGGATCTTCTATCATGTTGCAGTCCCCGATTTTATCTAGAGGCATCAGAGCAAACTCGCGGCCGT
CGCTCTCGTCGCCGATCATGTGGTCCTTCTCAATCAACGCATCCCCTATCACGCGCGCCACCAGCTCCGGGTGCTGCAGCGCCTTCATCAACGCGCCCAC
GAAGTCCACCTCGGGCGCATACCACTCGATCTTGCCGCGCTCGTTGAAATGGAAGTGGTTCACGCACGGGTATGTGACCTCCAGGCCGATGAGCGACTGC
GTCAACGCCTCGTCCCCCACCAAGTGCGGGAACACCTCCTCCACCGTGCGTCGAGAGAACCGCACGCGCAAGTCCGCCGTAATGGAGACCACGAGCGGGC
CGTCGTCGCAGCGGTTGTCCGACGTCAGCAAGCGAGGCTCCGCCAACTGCACCACCCTCAGCGACGTCATGGTCCAGTCGATGGCGGCGTGGTACAGCGA
GTAGCGCTCCCACTGATCCAGCAGCAGCTCCACGCCCAGGAACTCGCCGAAGCGCACGTTATTGTTCATGACGGCGTTCAGGAAGCCTCGCTGCGCGTTG
GTGGCCTGCGACACCAGCGACGCCGACGCGTCCTGCTCGTCCACGGCCAGACGCACGGGCGCGCCGTGGCTGAAGAGCGAGCAGTACTCCTTCACGATGA
GCGCGGCGGCGCCCAGCGGCGTGCGGCGCT