Description :
From Genome Similarity Track
Location :
Scaffold_17:153258- 156017
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G007144Similar to ste6: Protein ste6 (Schizosaccharomyces pombe)

Sequence
2759 bases(100 bases per row)
GATGCACGAGATCGTCAAAGAAGGCGCCGTCGCCGTGCGCGGCCATTTCCTGGTACGTGTGTGTGTGTGACAATTAAAGGAGAAACCGTGGCTTACGATC
ATTATGAAAACACTTACGTGCCGGTTGTTTCTGCTCCTGTAGTGGCGCGAGCGCTTTGTCGTGGTCAAGCGAGGCGAAGTGCTGATCTTTCGACGGCGCG
ATGGATCCGTCAAGGCCAAGGTATCCCTTGTTACATCGAAGTGGACCCCATCGTTCTCCTTTTTTCTTTTGACCAGGTCAGTATCCTTGTGACTGTAGAT
CAGTCTCCTGGATCCAAAGCACGTGCGCGTGACGTTCCACAGCGAGAACTCGCACATCACACTCTCGACGTCCACGGGGAAGGGCGTGATCTTTGACTGC
CACACGACCTCGTGCCGCGACAGTTGGCTCGGAGCGCTATTCACGGCCCGCGGGCAACTCGAGGAAGAAGGCGATACAGAGAGCGATGTGATCCTCTCGG
GCGACGACAGTGACGCGAACGAGTCGAGTGCTGTCCATCAGCACGAGAAAACCGAGGACGGCGATGACGAAGTTGACGACGACCAGTACAGCGACGCGCT
TCTCGCATTCCAGGACGTGCGCAGCTCGATGATCCAGTGCCACTTGGCCATGAGCCTCGCGAAAGAAGACCTGTTTGTGGCCCCTGATGCGTCGCTGCGC
AGCAAACACCACCATATCCATGCGACAAAGTCGGAAGAAGCGCTGCGACTCGCGTGCATCCGTTCGATTCTCGCATTCATCGAGAGTTCGCCGCATGGCG
GCCGCGTGATTCTCCTGCACTTGGGTGTGCTCGCGTCCGCGGGCATCAAAGTCGACGACATCTTGCTAGCGCTGGGCGAAAAGCAGCACGAGACTCCACG
AAGGTCGAGTCTCACGTCTTCGACGATCAGTCTGCAGAAATTGTACGCGGCGACGTTTGTGCGTGACATGCTCTTCCACCCGATTTATAGCAAGCGGTTA
GAGGTACAGACGGAGCACGTGAACGCGATCATCGACCGGTATTTTGCGCATTGCCGACTGCGGCGCTTTAGCCACGACGACGAGCACATGATGCTCATGA
GCACGGTGCACCCGATTTCCGGCTTGGAGCTCCTGGGAGCTGCTGGTGGTCCTGCGAATCCGTTGAACGGCATCCGTCCAGCCCAGCCGTTGCCCTCGTC
CTCTATAGCGAAGATTGGGGTGCCTGGGCTGAAGAAGAAGCGCCATTCATTTCCAAACATCCTCACACCATTGCGCATGAAGCGAACGGGGCTGCTCGAT
AGCTCCAAGCTGGACGAGTTCCTAAAGAAAGGTTGCTCGTCGTCTCAGCAACAGAAAACAACTTCAAAGAATGCTCCGGGCAGCGACGAAGACGACGTGG
TGCTGCTCGAGGACAACCGTGTGACGAGCACGTCGGCGTCGTCGTTCACCGACACTTCAGATCTGTTGTTCCATGACGAACGCAGCATCCCAGCGCCGCT
GCAGAGCCTGCTCTGGCGCAACTCGTCCTGCCAGGAAATCGCTGAGCAGATCACGATCTTCCATCACCACCAGATCGCGCGGTTATGTCTCTGGGATTTC
TTGCACAACCCTCGCGAGGCGTCCAAGGAGATCTCAGAGACGTTCAACAGGTTGGTCGCGTACTTTGTGTGGTCTGTGCTTGTGGAGGAGACGTCGAAGA
ACCGCGCCGAGGCCATCGAGAACATCATCTCGATCGCGCTTTCAGCGTGCTCCGTTGCGCTCAACAACTTCCATCTGATCATGGCCTGCGTTGGATGTCT
CGGGGACACGCCGCTGATGGTCTCGCGCATGCCGACGACCTGGAAGCGCGTGCGGCCAAAGTTCAAGACCCACCTGCAGGAGCTGCGCACGCTCTGCGAC
CACACTGGAGGCTTTGAGAATCTACGCAAGCGCCAGGCGATCATGAGTGGGAAAGGCAGCTGCATCCCGTTTATTGGCGTGCTCGGTGTCGCGCTCGAGC
GACTGCGATCGATCCATTACTTTAACGACCGCAAGCTCCTGGACTTTGACAAGCTCGAGAAGCAGTACGCGGCGCTGAACGTGCTCGAGAACGGTATCCA
GAAGCCGTACGTGAATATCAAGGTCAGTGACCAGATGCACGCGTTCTTGAGTTCTCTGGCGCTGGAATTCGTCACCCCAAGGCTGCTGCAGCTTCGTTCG
CAGCAGATCCTGGTACTTGAGACCGCAGCTTCGGCCTCTTCATCGTCTTTGCGGCACACGCCGTTTCTTCAATCGTCATCCTCGTCGGCAGCAGGTTCAG
GCTCCGGTGGTGATTCTAGTGACGCGAACCCAGCGCTCATGTCGTTCCGCCATATCTGCAGCACGCTGGCGATAGTGCCACACACCCAGGAACGCATTGA
GATTGGCCTCGAAGCACTCTTCGCCGACGAGCGACAGCAGCTGACGCGCCAGGTGCGCAAATTCTGGGGCGAGTTCAAACAGACTGTGTGGGTCTCGACG
TACCACACCACAGTGCTCGGCGTGCGCAATTGCATTGATACGTGCATGCGCGACATGATGGCGGCGAAGACGTCCGAGTTGCAGCAGATCAGCGCTCTGG
ATGAGAACGCTGTCGAACTACAGTGCTTTGTGTATGAAAAGCTCGTGCGCATCGTGACGCAGCCCATTTTCATGTGGCTGATGGCCAAAACCAAGTACAC
GTTTGCAGCAGAGGACAAGCGAATTGCCGCGTTCATTCGGCAGAACAGCACTCACGCTG