Description :
From Genome Similarity Track
Location :
Scaffold_71:153252- 155526
Sequence
2274 bases(100 bases per row)
GTCGCGCGCCTCGGAAGAGAAGTGTGAATGGATGCATCATCTTGGGTTGGGGCCACCGGCACCGGCGCTGTCGCTCGCCGTACGGGCTCTGCCATCGCGT
GCCTATTTGCAGCTCCTGCTCCGGTTGGCAAGTGGGGCAGAGCCACAGCGGAAGCAAAGGTTGACGCCTGGTAAGACGCACATGTAACGCGGGCTGCAGG
TTCTCCTGCTGCTGCTGTTGCCGGTCAGGCTGCGGATCGTCTGGTGGGTGGACCAGCGGAGGCTATGCACGTGTTGAAAATCCGCCGAGCACTTGGCAAG
CAGCGAGTTTCCTGCTTCTATGCAGACTTCAGCCTTGTGAATCTCGGCATGGCTGTTCCTGCTTGACAGCAGCGACGGCTAGAAGTTGGGCACGCGCGTT
ACACTTGGGCTCGAGCGTCGGGTCTAAGACCCCGGCAACAACACGAAACACATCTTGCTTTCGTTCTGAGTCGGTGTATTAGACCGGCACGTTGTGAGTC
AGGGTCTTGTCCGAGCTGGCCGTCAACCTCAGGAGCGAATCGAGGCTTTCCTTGCTTGAATTGGTCGGCGCATTTGCATTGCATCGACCAAAGGAGTGCA
ATGCAAGCAGAGCGCAGGTAGTTAGTGTACAGTATTATACATGTACACTCAGACCTTAGCCAGGAGATTACCGTTAGTTATACTTGCGTATCGGGCACAT
CTGGCTGCAGGGCAGCGGATTGAGTCAGCTGTTAAGCCGTCTCCGGAGCTTGGCTCACGCTGCGCCAAGGCGATCACTGCGGCGAGGCTCTGCTGGCGCT
CGCAATCACCCATAGCGAGACACAACATCCGGCACGCAACAATAGAGACGAAGGCGGCACTCCGTCACGATGTGCACTTCACTTCGGCACTTCGACCCAA
TGTTCGAGGCTCGAAACTCGGTGACGGTTCCAGTCGAGCGCCACCAAGCGCGCTTCTTCGACGGTCGTTTGATTTGGCGGAGAGGCAGCTAATGTCCCTG
AAAACGACCTGCAGCCGTGCGGGCGCCCGACGCGAAAGTGAAATTGCGCGCGCAACGCCGAATTTCTCCGACAATTTTAGGGGAAGGAGTGCTTCTATGT
TGAAGTGCGCCCAGCAGCCGCTTGAGTTGGCTTGACGGACCATTCAGTGTGACCGTGACGACCCACCCAGCTGATGCTGGTCATCGTGCCCGTAAGGCGT
CGTATCCTACCTGGGGATGTCAACGTTGGGACCTTTGGGTCCCTCCAACTCGCTCCAACTCGCTCCAACTCGAACGTTGCAAGTTGGAGTTTGAGTATGG
CGCAACTCCGCCCAACTCTTCGAAATCTTTCTCGATACTCGAAGCAGTATATTTTTCCCTCCAAGCTTGTTGGATTTTCCCGCTGCTTTGTTCCAAAAAA
TGGAATTTCCATACTACCAGAAGCATAAGGTCTAGTAATTCAAACAAGACAAAATGGACCAGTGCGGGCGGAGCAGAGGTCGATGAGGCGGTCGCGGGCC
ATAGCGCAACAAGGCCCCAAGCGCATACTCGGACAAGACTCACGGACACCATGGCCATCTCTGAGGTGCCCTCGTCGCCAAGCGATACATCCCGTCGTCT
TTTTCCGGCCAAGAATAAAAAGAAGAGGAAGAAAGCTAAGGGAACCAAGCGGCCACCAGTTCAGCTTCGATTCATGCTATCGCCACTGCCGAAGCATTCT
TCGGCTAGGGACCAGGGCACAGCATCCAAGGGGCCTCGCGGTGAGGCGTCTCCAACGACAGCACCTGTGGAGACGGTTATCGAGAGTGAGGAGGAGGAGG
AGACTGCTGAACCTGAGCTACAAACCTGTCCGGTGCCATCAAATGCCTACGACATCTCCGGAGCCCACAACCCCTACTGGTACAAGTTCATCAAGTTGGT
GCCACGCCCCGAGTTCGAGCATCTACACAAGCCGGGTAATAAACATGCTCGTGCCGCCTACTGTGCGAAGTGCAGCGCTGAGGTTCACTTTGAAAAGGGA
CGAAGCCACGTTAAAATGCATCTGCAGGTTCATCACCCTGCATACCTTCGAGACTGTGAGGAGAAGAAAAAAACCGCCAAAGACGCCAAGGTTACCATTG
CCAGTGGCGCCCCTCACTCGACACCTTCGAAAAAAAGCGGGTTGTGGCCGTGACTCCAGAACAACAGCGGCGGGCGACAGTATCTCGCGTTATGGATCGC
AAAAAATATGCGGCCATTCGTGATAGTTGAGGACGAAGGACTCGCATTTTACGTCAGATACATCACTGAAACAC