Description :
From Genome Similarity Track
Location :
contig_18:153200- 154643
Transcript NameFunction/comments
g3709.t1hypothetical protein PHYSODRAFT_481348

Sequence
1443 bases(100 bases per row)
TAGTCGCCTTGGTGCTCAAGTCTTTGCCAAAACTCAAGTACTGATTCATTTGGTGTGTAGTCCTCTTTTCGTGCAATGTCGACAGGATCTTCCAGCCATC
GATCAAGTTCCTCTTCTGCGCGTCGATCCTGCCGGCTAAAGGTTGGTGGTCGGCTTGATCTCGGCGCAAATTCTGCTTCCAGTCGACTGACTTGCACAAC
AGGTGCAGGTGGTTCAAATTCAGAGACGTCCGCGGGTTCACTTACTGCCTTAAGTAAGTCCAATAAGTTGCAGCGGATTTTGGCGTTCACATCATTCTTC
CTGGTCACAGCATCCCTTCCGCTTTTGCCATGCTGACGGCACGACAAAATCACTGCACGATCGAGGCTCCTCTCCGTTCGTTTGAAGATAGGGTGGAGTT
TCAACTGCATTTCAAATACAAATTGACACTTGTGGAATTGCTTGTCGTTGTAATATCTGCTGAAGAAGCGTTCGTCCAATGCTCTCCGCAATAGTCTCCG
TACATCCGCAGCCAGTGGTGTAAGGTCACTTGCAGGAATCCAACGAGGATTTTTGTCGGTTGATAGGTAGTGTGGCAAAGGCTGATCAGGGTCGAGGTCG
TGAATACGCATCATATACAACTGTACGAGCACGTCGACTTGAACAGGATGCTCTGCTTGACATGTTCGCTTGATCTCACCGATTTGCTTCAGCACAGACA
ACACATGAACCAAGTCGTCATGGCGATTAGCCAACGGGAACTCTGGTGGTGGCTGGTTGGCACGAAGTGCTTTACGAGCTCGCTCTTCATACCACGCAGT
TATTGCTGGCCACTTCTCAAGAACTCTCTCCAATGAACGCGTCATGCTCAGGAAACGTGAAGTAGAATATCCAACAAGTCGCGTGGAGGCACCCTGAGTC
TTAGACTTACAGAGCTCTGCAAATAAGCTCCCAGTGACAGACACGACCTTGACCTGAAATATTGTTCTTACCATCCGTGAGATTAAGTCCGCCATCTCCG
GGTTAGCTGCAGCACTAGCAGCTCCATTTACACCACATGATGACTTTGTAGCTGCGTGGGCCATGTGTGCGAAGCACCACTCCCAGTGCAGATTGAGTTC
TTTGCACAGCATCGATTTCACGTCACCCCCGAGTCGCTCGTAGCCCCGTAGAAATCGCTCGTCGCTAAGCCAAAGTCCTCGAGCATGTGCTTCAACCACC
CTTTGAAGGGCTTGACAATGCCGCCATCACGATCTCCATATGCGGGGTTGAACTTTCTCGTTCCCAAGAGAATGGACTTGTACTCCCAGGCCTTGTCCAC
CAGGTAAACCCGCAACCCAAGAAATTTGTCTTGCGTTGTTTTGCAAGTCCAAAAATCTGCCACGAGCGTAAAGTTCGGGTAGTCCTCTCGGTTCTCTTGG
AGGTAGTTAGTGATCTCCTTGCGTGTTGAAGAATACAGCTCCA