Description :
From Genome Similarity Track
Location :
contig_18:153161- 158223
Transcript NameFunction/comments
g3709.t1hypothetical protein PHYSODRAFT_481348
g3710.t1hypothetical protein

Sequence
5062 bases(100 bases per row)
ATTGAGAACAGCACTCTCACAGCTTTCGGTATGATACGGTAGTCGCCTTGGTGCTCAAGTCTTTGCCAAAACTCAAGTACTGATTCATTTGGTGTGTAGT
CCTCTTTTCGTGCAATGTCGACAGGATCTTCCAGCCATCGATCAAGTTCCTCTTCTGCGCGTCGATCCTGCCGGCTAAAGGTTGGTGGTCGGCTTGATCT
CGGCGCAAATTCTGCTTCCAGTCGACTGACTTGCACAACAGGTGCAGGTGGTTCAAATTCAGAGACGTCCGCGGGTTCACTTACTGCCTTAAGTAAGTCC
AATAAGTTGCAGCGGATTTTGGCGTTCACATCATTCTTCCTGGTCACAGCATCCCTTCCGCTTTTGCCATGCTGACGGCACGACAAAATCACTGCACGAT
CGAGGCTCCTCTCCGTTCGTTTGAAGATAGGGTGGAGTTTCAACTGCATTTCAAATACAAATTGACACTTGTGGAATTGCTTGTCGTTGTAATATCTGCT
GAAGAAGCGTTCGTCCAATGCTCTCCGCAATAGTCTCCGTACATCCGCAGCCAGTGGTGTAAGGTCACTTGCAGGAATCCAACGAGGATTTTTGTCGGTT
GATAGGTAGTGTGGCAAAGGCTGATCAGGGTCGAGGTCGTGAATACGCATCATATACAACTGTACGAGCACGTCGACTTGAACAGGATGCTCTGCTTGAC
ATGTTCGCTTGATCTCACCGATTTGCTTCAGCACAGACAACACATGAACCAAGTCGTCATGGCGATTAGCCAACGGGAACTCTGGTGGTGGCTGGTTGGC
ACGAAGTGCTTTACGAGCTCGCTCTTCATACCACGCAGTTATTGCTGGCCACTTCTCAAGAACTCTCTCCAATGAACGCGTCATGCTCAGGAAACGTGAA
GTAGAATATCCAACAAGTCGCGTGGAGGCACCCTGAGTCTTAGACTTACAGAGCTCTGCAAATAAGCTCCCAGTGACAGACACGACCTTGACCTGAAATA
TTGTTCTTACCATCCGTGAGATTAAGTCCGCCATCTCCGGGTTAGCTGCAGCACTAGCAGCTCCATTTACACCACATGATGACTTTGTAGCTGCGTGGGC
CATGTGTGCGAAGCACCACTCCCAGTGCAGATTGAGTTCTTTGCACAGCATCGATTTCACGTCACCCCCGAGTCGCTCGTAGCCCCGTAGAAATCGCTCG
TCGCTAAGCCAAAGTCCTCGAGCATGTGCTTCAACCACCCTTTGAAGGGCTTGACAATGCCGCCATCACGATCTCCATATGCGGGGTTGAACTTTCTCGT
TCCCAAGAGAATGGACTTGTACTCCCAGGCCTTGTCCACCAGGTAAACCCGCAACCCAAGAAATTTGTCTTGCGTTGTTTTGCAAGTCCAAAAATCTGCC
ACGAGCGTAAAGTTCGGGTAGTCCTCTCGGTTCTCTTGGAGGTAGTTAGTGATCTCCTTGCGTGTTGAAGAATACAGCTCCACGATAGATTCCTTCACCT
GCTTTGTAGTTATCTTGGCCTTCATCTCGTCCTTATAGAGTAGCGCTTGGATTAGTCTTGCCTCTTCGTACTCCACCATACGAAACGTCAAGTTATGGTT
GATGATCATGAGAGTGGTCATCAGCACGTTTAGCCGGGTTGGGTTGTTTGAGTACAGGGCGGACGATGACAGGTGGTTGTAATCATGGTCGTGTTTGCGC
TTCTTGACGGTCGCTATCTTTGTTTTCGGCGAGCCAACGTTGTGTATCTTCTGGAGGTGCTTCACGGCCATGGTCGTTTTGCCAGCATAGAGCTTGAACA
GGTTTTTTCCTGACGTCCGACACGCCTCGTCGGCCAAACAAGCCCACGCGAAGACCTCCTTCTCGTTCTCGATGTACTTGACACGAACCCCCCACTTGAA
TATGTACGAAGTCTCCTTTGGTCGTGGAGGCACCAACTCGAAGGGTCCAAGGGCCTGGAACTCTTTCACTGCTTGGAGGACCACAGAAGGTGGCTCTGTC
ATCGTCACGCGTTGGCTGGAGGTGTCGTGGGTCCCTGCAGATGTCACGAGTGTGAAGTAAGTCCCCGATGCGGTCTCTAGTCTTGTCGGCTGCGCTGTGA
GCTCGATGCTTGGCGGCGGAGCCTCTGACCTGAAGTCCGAGGACTAAAGCTGAGGCTGGAGGCACAGTGAGTCCCTGCGGTGGCCACGAGTGTGGGTCAC
AGGTGGATTTAGTCCATGTACTGCTGCTTCAGGCGGAGTCCTCTGACCTTCTCCTGAAGTCCTTGACTTGATCCGTGTGCTGGAAGGTGCCGTGGTCCGT
GTGGTGGTCACGAGCATAGACTTGCGGTGCTCAGGGTCCCTGGTGTGATCACGAGTCTGTCGGCTGCACTTCGAGCGCGTCGGAGGCTCAGCACATGCGA
ACGCAGGCCGCTTCTTGGGCAGAGGATATCTTCGCGAGTGAGCTCGATAAATTTCAGTGCGGCTGTGGAAGATCGTGCGATTTTCAGCCAATCCAACGCG
TAGGATACGAACACGCCAGATCCGCATAAATACGAAATGCGCGAGAACGAATATCGGGAGGGAAGCTCGCAAAAATGTTCGTTGTTCTCGCACTTTAGCG
AGGAGAACACGAAAATCACGTTTTTCATGTTCCCTCTTTTTCGTGGAAGCGTTTTTCACCTTTTTTTTTGTTCCCCTACCCGCATGTTCGTCCAAGGCTT
GCAAAACCGTCACGCCGGACTTGTGGCCAGTCGCACCTCATCATTTAAGTGCTCGACTTTTCAGTGTCCGCCACAAGATTTGAGAACAAGCCGAAAACGT
TGCGTTGGCATGGTTGCACACGCCAGTCTGGCCTCTTTCGACCGATCTGTCGCATATATCAACGTGTAGTCTTGTCAAGTTGCGGCGTTGGATTCTTTTT
TTTTGTCGTCGTAGGTAAATACTCGTGGCGTATTAACCTGGACCTCTTTTCGACTTAATGGCGCGTGCCTCAGGTGAAACTCAACTAACTTCAATTTACC
GCGGGGTACAGAAGAAAGGCTCAACTCGGAGCTGAACGACATTACGAGCCAAAAATTCCTGCAAGTATGCTGCAACTGAGGAGGCTCACGCACAATGAAA
CGAAAAAGATACGACCCGAAACACACAATCGATAGCTTGAAGTCTGCGCCTGTGGGGCACGTCTCACTCGGCATTTTGCCAGATTCAGCACAAGAAGCAC
TACACCCGCCAAGACGGATGACATTCGACCACTCCGTCATTCCCCTTCATGAAGAAATTCGGGACCCACTAGCAACTTCGACTTCCAACGAAACTGAGAG
CACGGTGGATGACCGATATCTTCCACTCAAGACAAGCAAGTCTAACGACTTATGCAACCAAGAAGAGCCGCTAAGAAAGCCTCTTGACTACAAAGAAAAC
CCACTCAATACTGCTGGTTTTCTTTCGATTGCAACGATGTGGTGGATGCATCCACTCCTGAGGCGCGGATACCAGGCACCATTGGATGAGGACACTGTTT
GGGACCTCCCTACGGCTGATCAAGCACGCCAACTCCAAGAAAAGTTTAACGTATCGTTCGCTGCAGAATCGCAAAAAGTCGAGGGACAAACAATAGCGAA
TCCAAAGCGACCGAATGTGAACCGAGCGATTTGGGAGAGCGTCAAACAAACCTGGGGGGTTGCATTTGCGTTGCACCTGATAAGCGCAGGCCTCATGCTC
TTCCAACCGTTCTTGATCAAGGCCATTCTCAAGAACATCAAAGGCGAAGACAATTTTCTTGGAATCTCTTCGGGATACGTACTGGCTGTACTTCTTGGTG
TTGCAGCTTTCTGCAGTGCTACGACCATTAGTGCAGGACAGTTTTTGACAACTCGGGTGGCTTGCAACGCCCGCATGATTGTTGTCAATAGCGCATTCCG
CAAGATTCTTCGGCTGTCGGCTACCGCTCGACGAACGATGATACGGGAGAAATCGTCACCTTCGTGGGAGTTGACAGTGATCGAGTTGTGTCAGCTTACA
AGCTTGGGATGTGGTGCATCGTGGCGCCACTGATGTTGATCGCTGTGAGCGTCCTGATTGGAACGCAGATGGGGATTTCTGTCGCTCTGGCTGCTGCAGC
GGCAAAAGTGATGACCATATACGGAGCTCTCGCGATGTCCAAGCAGATCGGACTCTACCGCCGCCAAATTTCCCGCATTGGTGCAAACCGACTGAAGCTG
ACGAACGAGATGTTGCAAGGCATTCGAGTGGTCAAGTTCTACGGATGGGAAGACTTTGCCAACGAGTTGATTCACGAAATTCGCCAGAAAGAGATCGGTC
TGCTGCGCAAGTACAATCGTCTGCGCCTCGCTAACACGGTATTGATGTTCTTGGCACCAACACTACTCAACTTGGTCTGCTTTACTACCACAATTGCGCT
GGGCAATAGCTTGGACGTGGCGACGACGTTTGTTATCCTGGCACTCACCAATGCATGCCGTACACCCTTCAGTATTTTTGCGGATGCATCGATGGCCGTA
GCAGAGGCGATCACATCCACCAGTCGGCTGTCAGATTTTCTCGCTGCGGGGGAGAGCTCTCAGGATATCAAGCTAGACACTAATCGAGGTGCGTTACCGT
TAATCTCGATCGAAAATGGCGACTTCCGATGGGAAGACGAAGCCACTGCGCCGACACTCTCGAATATCAACCTCACGCTCCAACCTGGTACTCTTACTGT
GGTCGTGGGGGCTGTTGGTAGCGGTAAAACTAGCCTCGTCAATGCAATTCTCGGCGAGATGCAGCAAGTTCGCGGGACGCGTGTGGTTCGTGGAGACATC
GCATACGCGAGCCAACAAGCGTGGATCCAGCACCAAACAGTGCGCGAAAATATTCTCTTTGGTGAACCTTACGATGAAGAGCACTATCGCCAAGTGATCG
CAGCGTGCCAACTAGCCCCAGATTTTGCGATGTTGGAGCAGGGTGACCAGACAGAGATTGGCGAACGCGGCATTAACCTTAGTGGAGGCCAGAAGGCTCG
GGTTAGCGTGGCTCGGGCAATGTATCGTGCTCACAAGTTCGATTTTGTTGTTCTGGATGATC