Description :
From Genome Similarity Track
Location :
Scaffold_467:15315- 16478
Transcript NameFunction/comments
g11768.t1hypothetical protein

Sequence
1163 bases(100 bases per row)
TCCCAGCCTGGAATGAACGAACGCCACTTATGTTGCAAGGGAAAGCTTCTTCTTCTCTTATCAAGCAAAAGAAACAAACAATGATCTCAGCTTCCTATCC
TCCCCCCTTACTGGATTCTTTCACCCATCTCCCGAGGTACCTTCCAAAGATCTCTCACTCCGGAATGATTGCGGGTGTACCACCAAAGTGGTACGCCCCG
ATCGACATTTGCGATCGGGATCGCGATCGCAGTTGTGGCCACGATCGCATATCGAAATGATCGCACCATACCGCATACCGGTATACACCGATGACTGATG
GCGCCACTGTACCCATTGGGACTCCATACCCCTACCCCTCAGGTCCAATCTAATCCCTCCAAAGTCGGTCTTCATCAACCTCCGATCGTACGTCCGGTCC
CGTCCGATCCTAGCCCATCGTTGGTCCATCATGAAATTTCCAACATCCACTTCACCACAATCGCCCCCTGTACATGCCGGGGCTGCTCAACAGTCTTGGC
GTGCACACTCGTCACTTCTTCTTCTCGCTCCTGGCCACCACACCTCCACAGCACCATGTCAGACAACTCTTCGCCGGGTCAGAGGGATTTCACGAGCGAT
CCTTCTCCTCATTCGCCCCTGTCAGCTTCCTCCCGATCTCCTTCGTCGCAACAGAGGGTCACGACCTCGGACCCGTCCATCGCAGTTCCTGCAGCTCATG
ACGCCACTACTACAGTTCCGGCTGTCTTCCTCGGGCCTGTCCAGCGAATCGAAGGACAGCCTGGCGCTCTCCCGATCGACCCGTTGCCCCAAGTTGGTCC
CTCGTTACCGCCCCTGGACCAGACCACCATCCGGAGATCGCTGGCTGCGGTTGAAACCGCTCTGGATCGCGAGGGTGAGTTTCAGGCACTCCAGCGCAGC
TACAACGACTTGTTGCAGTCCTACTTCGCCTTGCGACAGCGTGTGGCAGACCTGGAGCACACAATTCGATCAGCAGCTCAGTCGGCGTCTCCATTCGACT
GCTTCGTCCAACAGAAGTACGACCAGCTGTCTCATCGTCTAGCGCAGTCCACCCTGGACTTAGCGGAAACCCGAGAAGCTCTGGCTCAGAGGCTCGACAA
TGCAACTGAGCTCGCCAACCTCCGTGATCGTATGCGCTTTCAAGATCGCGTACACGCAGAAGT