Description :
From Genome Similarity Track
Location :
contig_76:153099- 155538
Transcript NameFunction/comments
g10082.t1hypothetical protein

Sequence
2439 bases(100 bases per row)
AGTTGCAACGTTTGCGCGCCAACATCCGAGTACGTTGATCTTACCAAATCTATCAAATACGCATTCGTATTAATCGATGCCGCTCTTGCTCGCAGAGGGA
AATGCGCGAGGAGGACAACTGCAACATGTAGGCGAGTGTAGCATCAATCCGCTGAATGTAGCCATTTATTGTTGATAGTCAGTGTGCACCACACTAAACC
ACGTACCATACACCATTTACGAAACGGAAGCGCCAGACTGCATTCTTGGAAAATCTGAAGAGTCGAGTGATAGTCACCAAGTGACGTCGCTGTCTCTCCG
TGTCTGCGCCCCCCACGCCCCAGCTCCCTCCCATCACTAACCTCTTGTTAGCTGAAGCACCAGGCTACTTGTCTCCGTTGCAAGTGCGCCATAATCCCCG
AATTGACGTCACCAGAGCTGAACGATGGAAGGCCAAGTGGTGGAGCTCACCGAGGCCGAGCAGGCCCAGCACCAGCTGCAGATGGAGCAGCAGCTCAAGT
CTTTCTGGGCAAAGCAGCTACTGGAGATGGAGCAGCTCGAAGTGGGCAGTGAACAAGGTGCCGTGGACCTAAAAAATAGTTTTTTGTGACGCACGGACAC
TAACTTTGTGCACGATCTGCGACCTGGTGACAGACTTCAAGAACCACAACGACCTGCCACTCGCGCGCATCAAGCGCATCATGAAGTCGGACGAGGACGT
TCGCATGATCAGCGCTGAGGCGCCCGTGCTGTTCGCCAAGGCCTGCGAGATGTTCATCCTGGAGCTTACGCTGCGGTCGTGGGGCTACTCGGAGAAGAAC
AAGCGGCGGACGCTGCAGAAGGAGGACATCCAGACGGCCATTAGGAACACGGACATCTTCGACTTCTTGGTGGACGTCATCAACTAAAGAGGACGCGGTA
GACACACACCAAGCTCGACCGAGTCTAGCCAGTAGCTGCCAGAGATGATGTAGAAGAGAGAGTGGGTGGAGACTGGGAGAGCTGCAATATAGCGCTTGAT
AGCAATGTCAATGGAGGCTTCATGTGGACACTTCCTTGGTGTCCTCCGTTGTCGCGTGGAGTGGTGCACACCAAAGACCACGTCATCTCAACCTTGAAGT
ACCGGGACAGCGTCATTCTGCTACGCGGACGCTCTCCGCTTCGACAGCGGCGCTATATGCTGCTGTGTAGTACGATCCTGCCGCTATGGGCCTGGTCGCG
AACCTCTACACCTTTTTGGCGGCGGCAATTCAGCTCACAGAGGCAACAGTACAACTTGGGTGTTGAACCAAGGCAACGAAGCCCGTCGGCAAAGCCAGAC
CCGTCACCGTCTACCAGACCAATTCCAGCCATACTTCCTCAGCGCTAGCATGGCATCAAACTCAATTAGTGCAACACATCCCACGTACGGCAGGCAGCAA
GCAGCTTGCAGTCCTTGTCTTGCGTTTCGTACTTAGCCTAGCACGGTCGCCACGTTCCTAACTTGAAGTTGCGAATATCGCGTCAACTGCTTTGCGTCAT
TCGCCATTATCCGTCCAAGTCCCCCTTAAGCCTCAATGCTGCACACGACCTTCCTCCGCTCCTCGCACGCGCTCGCTGCTCCACTGTGCCGGACGTTGTC
CACTGTTCGCCTCCAAGGACCAGGTGGGCGTCATCGGTCTGGGCCAAATGGGCGGACGCATGGCCGACAACCTCCGCAAACACGGCCACAAGCTTGTCGT
GTGCGACCCCGCGCCCGCCAACGTGCAGAAGCAAGTGGAAAAAGGCGGTGCTGTGGCCGCCTCCACGCCCGCCGAGGTGGCCGAGCAGTGCGACACCATC
ATCACCATGCTGCCGTCCACCGCCATCGTCGAGAGCGTTTATCTGGGGGACGAGGGTGTCCACGAGGCGCTGCGCAGCGAACACTTGCTGCTGGACTCGA
GTACCATCGACCCGATCTTCACCAAGAAGCTGAGCACCAAGCTGCACGAGCTGGGGGCACGTTCGTGGACGCTCCGGTGTCTGGAGGTGTAGCAGGAGCT
CAGAACGGGACGCTGACGTTCATGGTGGGCGGCGAACCGGAAGAGTTCGAGCGTGTCAAGCCGTTGTTGAAGGCCATGGGCAAGAACTTGGTGTACTGCG
GTGGAAGTTGTACGTAGTTGGAGAATATGGTGGCTATAGGAAGTGTGCTGAGTGGGTTGTGCGTTTTGGATTGTAGCTACGGGGCAGATCGCCAAGCTGT
GCAACAACCTGGCATTGGCGATTCAGATGGCGTCGGTTGCTGAAGCGATGAACCTGGGAACGACGCTGGGTATTGACCCCAAGATCCTCAAGAACATAAT
GGACACGTCCACGTCTTCGTGCTGGTCTACTCTTGTGTAAGTGGAGTGGGGTATTGTTGCTCAGTCTGGGCCGATGCTGACGTTTTGCTGTTTGTACAGT
AACCACCCGTACCCAGGTTTGATGGAGAATGTGCCGTCA