Description :
From Genome Similarity Track
Location :
Scaffold_1:1530802- 1534563
Sequence
3761 bases(100 bases per row)
GGAGTTGATTGTCTTCTCGGAATGGACGCCAATTGTGATTGTGATGAAGAAGAACGGTGTGGACATCAGGCTGTGCATCGACTATCGACTGGTCAACCAA
CTGATCAAGCTCTCACACTACCCTCTACCCTTGATTGACGATCTGTTGCTCGGGTTTGAGGACGTGATGTAGTTTCTGAGCTTGAACATGGCCAGCGGAT
TCTGGGCAGTGCCGATGACACTCCGGGCCAAGCTGATCTCAGCATTCATCTGTCCGCTGGGACACTTCCAGTGGAAGCGCATGCCGTTTGGTCTCAAGAA
CGCCCCGCTGATCTACCAGCAGATGCTCGATAATTGTCTATGGGGTTTCGTGCGACTTCCGCCCTGCGAGGAGGCCCGAGTTGATCCGGATGTGCTGGAG
TTCCTAGGAATCGAGGTGGACGACTCCGCTAGGGAGGAAGAAATCCCGCCTCTGTCTGAGGAGAACTACCGTGTTCCGGCGAAACATTCCGGCCCCGCCT
CAGCTGGGTCCTGTTCTGGGACGAAGCTCTTACATCGACGGCATCGCGTATGGAGCGGAGACCTGGGACCAGATGTGCGAAGTCTTGGATCGGTTGCTTT
ATCGACTGAGGTACTGGGGAATTTCGGTAAGCTTGGCCAAGAGTGAGTTTGGCAAGAAGTCTATCTCCTACTTCTCGCATGTGATTGGAGCTGAGGGAAT
CCGAGCTAAGCCGAAGATCGTCAAGGGAGTCAAGGACCTGCCATTCCCGACGACGCTGAAAGGAGTACAGTCATTCCTGGGAAGTCTCAACTACTACAAC
AAGTTTATTGAAGACCTCCCGGTTGTAGCGTCTGTGCTCTACGAGTTGACGGATGAGCAGATCCAAGCTGGACGTGATCTCGGCCGAGCTAAGGAGGCGT
TTGAAATCCTGAAGCAGAAGATTGTCTCTACCCCACTGCTCAGACACCCGGACAGGGAGAAACCGTTCGTGATTATTCTACACGCTAATCCCTGGGCGGT
CTGTGCAGTGCTGGGCCAAGAGTACGATGGAGTTATTTTCCCGGTGCGATACACTGCATGATCAGGAGCTCAGATACCACCCGGCTGAGAAGGAGGTCGT
AGCGTTGCTCCGGGTTCTGAGAGTTTTCTACTCGATGCTGAGCGGTTGCAAGCTGCTGAAGGTCTACACCCGGTATTCTGTTGTGAAGCGGTTGTTCAAG
TCTCGATCGCTAGAGGGACGCTGTGAGCAGTGGGTTGCACGTCTGTCGCCCTGGCCTTTGGAAGTTCACAAGGTCGAACGCGATGAGGATGGTTTGGTCG
CGATCATGGGAGCTGGGATCACCCCCCCCTTCCGTGATCAGTTGGATAAGATCGCAGAGAACCTCATCCCAGACAAGGGACGAGTTGTCCGAACCCCACC
GATCAGCTTGGAGATGCTGGAGGCGGACTACGAGGGATGGCTGCTCAGCTTTGATGGAGCTGCCAAACTTTCGGATCGCTCTGGTGCTTCCGGCTGCATT
CTGTGGAAGCTCCCGTCCTGGGACGTGGTCGAAGCTCGAGGATTCCACTTCGAAGGCATTACGGTGAACGAAGCCGAGTACCATGGACTACTCGAGGGAG
TTCGCATGGCGAAGGCTCGTGGCATCTTAGACCTTGTGGAGGTCGGTGACTCTCGGATTGTCATCCAGCAAGCTCAGGGCTTGATCCAGTGTCTGAGCCC
AGGGCTGGAAGTGCTGCTGGTTGAGTTTGAGACGCTTCGTCCAGAGTTCCAACGATTGCGCTTGGTACATGTGAAGCGAGAATATAACCCAGCTGCGGAC
TACCTCACGTCGAAGACTCTGGTGACTCAAGGTCCTGTCGCCATTGAAGATCCGGTTGAGCTGGTTCAGCTCAAACAACTGAATCGGATCCCGGAGAAGC
TGATCAAGGTGAATGAACCTGAGCCAGCTGAACCTGAGACTGAGCAGCGTGACACTCAAGCTGATGTAGAAGTAGTGGCTGAGCCAACTCCGCTGGAGGA
TGCTGCCAAGCCCCTGTTGCCCAGCGCTAAGATCTTCGTAGTGACTAGGAACCAAGCTCGGGTCAGGGACGCTGAAGCCACAGCAGCCAGGGGCGACTCC
GACCAAGGTGTCGATCCCGACCAGAATGCTGAGCTCCCCGCTGAGCAAGCTCCAGCGTACTTACCTGAAGCGGCAACTCCTGCCGCGTCAATCGCTGAAC
GATGGAGACGCATCCTAGTTCTGCAGGAAGCTGAGCCCTGGACGAAGAAGCTCAAAGACTATCTGAACGGAGACTTGGGGAATATCTCTGCAACTGAAGC
TGAAGATGTGGCCAAGGTGGTGAACCAGTTCACCCTTGATTCGAGAGGAGTCCTGTACTATCTGAGTCGAGCTACTCCGGGAAGGCCCAGGGACGCAGCT
GGGAATCTGAGATTGGTTGTGCCAACGGCGCTGAGGGATGACTTGCTTCAGCTCAGTCATGAGGAGTTCCAAGGTGGTCATCAAGGGATCACTAGGACTT
TCGAACGACTGCGCAGAGAGTACTACTGGCTGAGGATCTACGCGGATGTGGAACGCTATGTGAAGGAATGTGTGGATTGTGTCACTGCCAAGGGAGCTCC
GCCCAACCCTGGGCCGTCGCCGGGAAACATTTTTGCGACTAAGCCCTTTGAGGTGGTCTCTATGGATTTCGTTACGCATCTACCCAAGTCCGACCGTGGA
AACGTGTTCCTGCTCCTGTTCCAGTGTGCATTCTCAGTCTTCATCATGTGCATGCCGATGGGTCTGACCACAGCTCAAGATGTCGCTGAGGCTGTGTGTT
CCAGAGGTTTGGTGCGAGCTCTCTGCTCCGCCATGATCGTGATTCACGCTTCATGAGTGAGGTGTTCGCCAGGTTCCGTGAGATGCTGGCAAGTCGGCAG
CGTGCGACTCTGGCGTACAGACCTCAGGCAAATGGCCAGCAAGAGCGCTCAGTGCAAACAGTGGTTCGAGCTATCCGAGCGTACGTCGCTGAGCCAGATC
AGAGCGACTGGGACGACCAGGTAGAGAAGTTGATGTGGGCTCTGAACACGTCCGTCGACGCCACCCGTCTCGACACGCCGTTCTACCTGGTTCATGGCTG
GGACCCTCACAGCACTTTTTCGGCCATGCTGGGACCGTCTCCGACGGGTTTGGATCAGATGACTGCCTATGAGTGGCGCCGCAAGACTCAGCGTGAGTAC
GAGCACGCTCAGGCCTGGGCTAAGGATTTACAAGCTGAGGCCAAGGACAAACGCTCGGCTGCTCAGACAAAAATCTGGGCTGAGCTGTCTGAGAGACTCA
AGAAGGCTTTTGAAGTTGGTGATGTTGTGTGGCTATACCTAGCTCAAGTGCAACCTGGGCTCACGAAGAAGTTCGCTCACCTCTGGCACGGTCCGTTCCG
GATTCTGGAGACCTCAGATGACTTCCGATGCAAGCTAAAGATCGAAGGACTGGGTTCAAGCTGTATCCTTGGGTCCACATAAGTCGACTCAAGCCACGTG
CCCTGTTCCCTGAACGACCTACAGTTGAGGTTGAAGTCGCTGAGGATGATGATCTGAACGCAGCGCTGTTGCTCGAAGATGCTGAAGAACCTGACGAAGC
TCAGAACGTGTACGAAGTGGAGGCCATCCAAGATGTGCGTTGGGTTAAGCGGACCCGGATTTCACGGAGGGTCCGAGAGTACTTGGTCAAGTGGAAGGGG
TACCCTGACACTGAGTGGTTTCCCATGTCCCAGCTAAGTTGTGGAGCTGTGCTTTACGAGT