Description :
From Genome Similarity Track
Location :
Scaffold_8:15306- 23605
Transcript NameFunction/comments
Phyag_g252hypothetical protein PHYSODRAFT_350602
Phyag_g253hypothetical protein

Sequence
8299 bases(100 bases per row)
GTAACCGTGTCATAGCCCAATCAGATCAGgcaggacgacgatggcaactcggacgatgccgcggctgctggtgctctACGGCAGCGAGACCGGGACCGCC
CAGGACGTGGCCGAGTTCGTGCAGCAACGCGCCTTCAACcggcagctgctggacacgcagGTCTCCGCCATGGACGCATTCCCCGTAGCGCAACTCTTGC
CGCAGTGCTCCACTGTGGTGTTTGTGGTGTCCACGACTGGCGATGGCGAGGCGCCCGAGAACATGCGCAATAGTTGGCGCAGTCTGTTGcgcaagacgct
gacgccgCAGTGGCTCAAGGGCGTTcgcgtcgctgtcttcgGGTTAGGCGACTCCAGCTACGCCAAGTACAACGCAGTGGCGAGGCGTCTGCAggcgcgt
ctgctgcagctcggagCTTCGGAGCTCATCGATCGTGGACTGGGGGACGACCAACATGCCTACGGATACTTTGGGGCTCTGAACCCATGGACGGAGAAGC
TCTGGACGGcggttctgcagctgcatccGCTGCCGGAAGGATTCGCAATTGATGACTCTCCGAAACCGATTGAACCTCGCTACTCGGTAACGTTGCATGA
GGCTGGAGATAAAGAGGTGGAAGACGCAAAAGTGTTGACGCCGAGAACGGACCAGTCGAACTTCTATGCGCCGCCACGGACGGCGGTGGGCAGAGAAAAG
GGTATTTACTTGGCTTCTGTCGTGGTGAACAAACGCATCACGGCCGAGGACTGGGAGCAGGATGTGAAGCACTTGGAGTTTGATATCAGTGGTGGTTTAG
GTGCTGGCGAGGCAACGGATGCTCCATTCCGAGCTGGAGATGTTGCCGTAGTGTATCCTGAGAACGTGACGGGTGTGGACGACATGCTCAAGTATGCAAA
GGTGGATGGAGACACTGTCATCTCGATCAACGCAGCCGACGGATCGAAACAGTTCGATCTGCCTTCCCCAATTACCGTTCGTGACCTGTTTACGAAGTAT
CTGGCAATTCTGGAAATTCCGCGAAGAAGTTTCTTCGAGAGGTTGTCACTATTCGCTTCGAATGAAGAGGAGGTACGTCCCAATCTCCCTGCTAACCCTC
TGCATGTCTGAAATTTATATTCATGTTATGTTGGGTATGCAGAaagagaagctggaggaatTGGCCTCAGCTGAGGGTGTCGACTTGCTCTACGACTACT
GCATCCGCGAGAAGAAAACGTATGCCGAGGCGCTGACGGATTTCCCGAGTGTGAATGTACCTTTGACGATCCTGTTGCAGCTCATTCCTCGTCAACAGCC
CAGATCGTACTCCATCTCTTCATCGGCTTTGCTCCATCCTGGACGCGTAAGATTTCGTCCAAGTGCTGTTTCGGTTGTTCATGATTGCAATGCTTATCTT
GCTCGCGTCTTCATGTTTGAATAGGTGCATTTGACTGTGGCCATTGTGGACTTCTTGACGCCGTATAAACGCCGTCGCGGCGGCATTTGCTCATCAttct
tccagtcgctggATCCATCAAAAGAACTAAAGTGCGTGCCGATGTGGATCAAGAAGGGTCTCTTTGAGCCTCCCACCCTCGAACGGGACATGTTGCTCAT
TGGCCCGGGAACCGGACTCGCTAGCATGCGGGCGATGGTGCAAGAGCGCCAATTCCTGCGCAAGCAAGTCCGTGACGATAGTTCGGGAAAGAGTTTCCTC
TACTTTGGATGCCGCCACGAAGATAAGGTACGAGACCGAGTGCTCGATCATTGCATGAGCCCCATCTAACGAATCACTTGCTACGGTGCAGGATTTCCTT
TATGGTGACGAGCTGCGTGGTCTTGTATCGTCGGGCGATCTCACCGAGCTGCACACTGCCTTCTCGCGCGACCAGGTACGCGTCAACAACTTTAGTTACG
GTGCGTGCTTTAAGCTGACGCTCTCAATGCATGCAGGACCACAAAATCTACGTGCAGACGCGTCTGGCAGAGAACAAAGAGGtcatcttcaacttcatca
tgaATGGCGAGGGCTACATCTACATCGCCGGCTCGGCCAAGCGAATGCCAAACGACGTCTACGAGGTGCTGCGCGACATCCTGCGCTCAGTGGGGAAACT
CCCATTGGCAACCGCAgagaaggtgatgaagacgttggTTCGGAAGAAGCGCTACGTGGTGGAATCCTGGTCATAGGGACTTTCCAACccagaatctgct
gcaccTGTAGCAACTGAAATACAGCTCACTTGTTAGACGTACCATGCAAGCCAAAGCGAAGAATCAACAGCATGCTACTACTCGTCCTAGAATTCACACC
AGATGAAGCTCACCAGCACCATTCCCTGTTTTGATTCGCTAAAACCGACAAAGGTTCATGGACGCCGCGAAGGAGCAGCATGTACGGACGTTCGTGAAGC
TCGCGAATCTCACGCAGACGTCGCAGCTGCACGAGTGGAACCTCGAGTCTCTCCATCGCGCTCTGCAATGGGGTtgcgcagcagaagacgcagtGGACGA
TGGTAGTGGCTCCCAACAGGACATCGAGGGGCAAATCCGTTGGTGGTTCCCAGTCGCGACGCTACCCACTTTGCCTCTAGATGGGGCCCTGACGGCAGAC
GCACTGCGATGCGCGAGGATCCATTTACTGCGGTCAATTCTGCAGAGtccgttcttggcgtcgcATCCGACGCGGTCTGAGTTACTGGTTGCAGTGCTTG
AGGAGCTTCAGAGGAGACGTGAAGACTCTTCCTACCCGCCAATTGAACAAGTGGAAGAGCATTCGCCCAATAGGTTAGAGACACCTTGACGTGCTTTATG
ATCACAATGATTCGACTTCTTATTGCTGAGTTGCTATGTAGTGCTTTGCTGACAGAAAAGGTTGTTGGAGCCTCACGGACGGACGCCATGCTGGCGATCT
CCCGTCGAATGAGCGACGGGTACAAGCATCTTCGTGTACAAGGTAGATCGTTGTTCTGTTAAAGGGTGGTGGGTGTACCTAACAGGGTGGTCCTTGCTGT
AGTGCTTTCCGGGTGGGTGTTGGTACCACCGCTCAAGAGTTACACGCTCTCGTCACGCACGTTGCAATTGAAGACCATGGCAAAGACGTTGCAGCGGAAT
GCAGTGGatgctcgtgcagcagttgatcCTGAAACATACCACTGCTTTCTGAGTGACCTGCGAGGCTGCTTTGAAGTACCTGAGAGCAAAGATGTCCGGG
TAAGcttgcaagttgcagtgaTTTGGTTTGCATTGCTGTTGGGTTAGCCACTTAACGGGCATACATACTTGCAGGAAGTTGtggtgttgatgctggtCAT
GTGCGAGTGGCCCAAGGAGGAGCCTCCACAGCTTCGGGGAATGATGGAGGATCTCGAGAAAATAGTGAAGGACTGGGTAATGAAAAAACCTATTCGGTTC
TGGACGTTCCAGCCATGGTTGGCAGCCATGCTGGCCAGCAAAGCGGAAGCCCTCGCAAGCATCTATGTGTCGGAGCTATTCAAGGCGGGACTTTTACAAC
CATGTACGATTGTACTTGTCCTACCAGTGAGTTTGACAGATACTTACGTACTAACTTATCGTCTTTTGCTTTGGTTTCAGGGGAGCAACAGTTTGCAGAA
CGTGTTGCAACGCTAGTTTTACAGCGTGAAGGCGTGGAAAAGATTCTCACCCCGGCCTTGACGAAACTGGACCCCTTTTTGCAGAGTTCCTACTTCAGCA
CAAATCCGGACTCTCACCGTTCGTGAAGTAATTTCCATTGCATTCAATTTATTGTCCAAGCGAACGCAGCATATCGACAACATCGTGATGACCACCTCGC
AATGCTAGGTCTGTTACAGTGGGATAAGGTACTTCCGGAAGTGGGAGAGTCATATCGACACTACCCTCGTCGATCAGTGCGGAGCAGCATTCCGCAAACC
CTTCTTCTCCGGCGATCAGCAGAGCAGTGTATCCAAATCGATTGCGCTGATTCACCAGCGATCTAATCCATTCTTGGTCAACAAACGCGGACTGGTGAAG
ATGTCTCAATATCAGCCGCAGCGAGGTTAGTGCATTGGACGCCGTGGCAAGGTGTAGAACTGAATTCCCGTCGACATCCGCAGCGAGCACACCAGCTCCA
TTGCTATGTCATCAATTGAGGTTAACTGCAGCTCATGGTACTATTTGGAATCTCAAAACCGTACCGAAGAAGGAAGCTAACAACGTCGTGGGCGTCCCAA
GCCGAGGCAAGTTGCAGAGCTGTGCGACCAGTGTGAGGATGGCGTTCGTCCAGCAGGGTCGGATCTTCGGCGTACAACGTGCTGATTGCAACTGCGTCGT
TGTCTACTGCAGCTTGCACCCAGGCGTCCAACAACTTCATGTGGAATTTCGAGAACAGTCTTCAGTGAGTAGTCGTGTATCAGTTTATTAGTTTGACTCA
GTTGACGCTACCAATGGTTACAACTGTCAGTCCGTCGTGAATCCATAcacctccgtctccagcatTGCATATAACACAGCCTTCAATTCTTCGCGCACAA
CGTGAAGCGGCAGATCCAAACGATTGAAGCAGGCGTGGCTGTGGATGAACCCGTCACCTACCAGCGATACTGATTTCAACGTAAACGGACACAGACGACC
ATCGTAGCTCGTCAACGCACCAAAGCCTCCCAATGGCACGCGTGACGAACCCGTcgaaaactgcagcagcctgcgACGATATTCATTCGGCATCTCACGC
ACCAATTCCCAGAACCATTGAAGAgctcggtggtggtgcaggtcTTCCGAGTACTTGGTGTTGCGCTCCCAGTCGTCCACGTCAATCTCGTCCGAGCCGC
ACAACAGGAAATCGAACTCCTCCGggtcgaagagcagcagcaactcgcgaGGAACGATTTCGTACAGACCACGTAAGAAGACTTGCAACTGTGGTGCGAT
GCTCTCCACAAGCAAGTACTGCCACTTGCGCTCCACAAATTCACACTTGTTGCTGTCAGTGACCGGGATTGCACTGCCTCCTGGCACAAGGTCGACGCAC
TGGTAATTCTCTCCATCCTTGACGGTAACAGTGAAGTCGAGTCCTAACGAATCTGCATTGTCGTTCTCCAATAGCCAACGAAGGCTTACATGCACCTCTG
GGTCCAGGTCTTCTAGATCTGAAAAACTGACTGGGTAGCCTAGCATCAGCTTTATCATTGGAGGCGCTAGATGGAAACACAACATTGACCCGTCCAGTAG
CGCACGACCGAGAAGTCGACCCGTTGCATACAAATGCAGTAGCTGATCTGGTAAGACGTCTGCATTTGAGCACGGACTCAAAAAGTAGGTCTGCTCactc
ttgttgctgcaaatgAAAAGTCCGCGAGCCGGATCCACGATAGCCTCGTTTAGCATCACAAACCATTCGCGGTGAAGCCCTCCAGCGTCGAGACCGTTCT
CGTCGAGAAAGTGAATGCGGAGTGTAGAGTGCACATTTCGGAGCGGGATAATAGCGAGGGATTCCAGCGAGTCCTTGAACACACTTGCCCGATTGACGTT
TAGTCGTAGGTGCTCTCGTTCTGTAGGCACCAACAGGGCCGAGGCAGCCATAACAAAGTGGGCATACTTCGAAGGGAAATCCTTGCTGGCGAACGCCATC
GTTTCTGTCAACGGCGTCGACATAGTGCGGTGCGCGGTAAACAACGTGCGAGCATTTAGGCCGATTTGAATGTTAAGTGGCAGCTTTGACGCGTCTGCCG
TAACGTCCGATGCTGGTTTGAGCACAGCGCGTGCGGCAATTCTTGACAAGCCTAGAACACGCTCGTCAACTGACTGGATTGGAGATCTTTGGCGTCTTGA
TCGACTTGGCACAAAACCACCATTTCCGGGTGAATGTTCTGGTTCGGAGATATTTGAGTTCCCTGGGTCATCACCAATAGCGTATGAATGATGCGATATC
CTTGTCTCCGTGACTATGGTCGGCAATGGATCCGTATTTTTTTTGCGAGTGTTTGACAAACTCGGTGGTTGTTCCGGTTTTTCAACGTCATCGAGTTTGT
CTGTTGCAGGTTGAAACGAAACAACAAATGCCGCGGAAAGCGTATCAACTCCAGCAAAGCCATTGTCCCGAAACCAATACGCTCTTCCTTCGACATCCAG
TTTGCGTACCCACTCCTTGCGCCTCTGAACCCGTAGCCGACGACGAGTGGACTGGATTGGAGGCACTGAAAATGATGACGAAGCCAACTCCAGGTGATGT
TCTCGCTTGAAAATGGACAAAAGCGATGTCTTGGTTGAGGTTCCCTTCCCTCCGACGTTGCTCCCATTGTTTCCACCTTGCTGTTCGCCCTTGTCACCCT
TCTCGTCCGCAATCGGCGCTTTACAAAGTGCACAGAAGCGAAAGCGCTTGAAGTTCTCAAACTCGCAGACTGCACACACATTGTATCCATCCTCTGCATC
CCTTACCGAACAAACATTTACATTATATCAGCTGTAACCGTTCCCTACAGTACCAGTCAATGCAACGGAGACCAACCTCAGTGCTGCATCGACGCGTCTG
TCTTCCGATCTGCATCCATATACAAGACACAGTTATCAACTGTTGCAAACTGCTATGAACATCGCATCGCACAGGAGACGCACTCGATGAGTGGCGCGTT
GAGTTCCGCCTCGcgctcgaacttcttgaacGAGCGTCGCGCCAACCAGCCAAAGAACAGCGCAAGGAGCAGAGCGAGCGCGCACGCTACAGCGATTGTT
CCGCCCACGGACATCACCAACTTGTCTGCGCTGGGGAGAGAATGGAAAGTGGCACGATCGCGATCATATTGACCGATATCTCGTCGGACCAGGTGCCTGG
GCTCTATTGGAGCTCTTTATCAGGTCAAAAGTCTTTATCTGCACCATGTTTACTAAGCTTTTTCAGCTGTTAAAATGGGGGTATAAGTACTTTTGAGGAA
TGCAGTGCTTGCCGCTAACAGGTGTACCGCAGATCGAATGTGCAACGTTTGCTTCGGAGACAAAAGATAAATCTCAAAATTATtattgcagcgctgcaga
gGAGAAATGTACCGCCTTCGCCCAGTACGGGGCTCTTGATTCACCCCCCCCGTGACAATAAAGCTAGTAGATACACGACGACCACACAAACGCGGCGCCC
AATGACGCCGATCACGGTTATGCCGTCGTGAAACCCGTGAGATCGGTATCCAGCGTGGCGTACAGCAtgctcttcagctccttTTTGCTGTGATACAGCG
GTAAATCCAAACGGTTGAAGCACGCATGACTCGAAATGTACTGCGTCATGCGGTACGACACACCCTTGAGGTTGAATGGACATAACCGACCGTCGTAGCT
GGTGAGACCGCGGAAACCCGACAGAGGAACGCAAGCTGACCCCGTCGCGAACAGTAATAGACGCCGTCGGTATTCATTCGGCATCTGACGAACGATCTCC
CAGAACCAACGCTTGACGTTCGCATCCTCCAGATTCGGAGACATTACAGTGTGGGCCTCCCAGTCTGTGACGTCAATTTCGGGGGACCCGCAGAGAAGGT
AGTCGAACTCTTCTGGGTCGAAAGTCAGCAAAATCTCGCGCGGAATGACTTCGTACAGACCTTTCAAGAACGCATACATCTGGTCTGCCACACTTTCAAA
AAGCACGTATCGGAAGCGCCGATCCAAATACTCGCGCTTGTTGGCGTCCGTAACAGCGACATTCCGTCCGTTCGGGATCAGGTCCACCACGACTTTCTCG
GACTCGTTTACCTGCTCGGTGAGGCTAAAGTCAAGCCCGAGATCATCCGTGCCGTCGTTGTCCATCAACCACCGCAGACTGCGGTACGTCTCTGGGTCGA
GGAACTCCATGTCAGCGAAGGTCACTGGCACACCCAAGATCACCTtcagcaacggcagcgcgAGATGGAAACCCCAGATACCGCCTTCTAACAGCGCACG
GCCAATCAACCGCCCCGTAGCAAAGTAGTAGGCAAGGTGATCCTCACCCACCTCGGCGCGGGACTGCGGGTTGAGAAAGTAGCTCTGGTCGGCCTTGTTC
GTGCACGTAAAGAGTCGCAGCGTGGGTGAAGCCAGCAATTCGTTCACCAGCATAAACCATTCGCGGTGCACCCCCCCAGCATCGACGCCGCTCTCATCCA
GAAAATTGATTCTCATAAAGGAGCGAAGGTTCTTCGGCTGGATACAGTACATGTGGTCCAGTGACTCCTCCAGCATGTAATCACGGTGCACCGACAATTT
CAGGAATTCCACTTCTGCAGGCACGATAAGCGAGGCAGTGCTGACAACAAAATGCGCGTACTTGGAAGGGAAGTCGCTCTCCGCCATGACCATCGCCTC