Description :
From Genome Similarity Track
Location :
Scaffold_96:153047- 154602
Transcript NameFunction/comments
g7507.t1hypothetical protein

Sequence
1555 bases(100 bases per row)
GCACGAAGAAGCAGAGGAGAGTCGACATTTTGACGCTTCCGGAGGTGTAGGCGGTCTCGCAGGCTTCGTAGCTCCCGCGGAGATGGACGCGGAGCCCCGA
GCGCGGATGTTGGACGTGCTGCTGGAACGAGCCAAATTGTTGCAGCGAATGGCGCTGGAAGAAGACGCACGGGAGCGTAAGGATGCGGAGCTAGCAGCGG
TGGAACAGGGACAGCCGACGCAGAACTCGAGGAGAAGCCCAAAAACAGGCAAGAGCGGGTCAAAATTGGCATATACGTCAGTTCCACCCAAACCGGAGCC
ATATCGAGGTATTGAGTCTCGACGGCTTGAGAAGCGAGCGCTGCATGATTATTCAAGAGCACTGGAGCTGGATTCAAGTAATACCGAGACACTTCGGTTG
CGGGGCGAGGCGCTCATGCATCTTGCACGGTATGAGGACGCATTAACGGACTTCTCGAGTGCGCTCAAGCTAGACCCCCACGATTTTCAGGTATGTATGA
ACCGAGCGAAGCTGTACCGCCAACGCGGCGATCTCAAAGGTGCAGTGGACGAGGTGACAGCGGTGCTGCGGTTGAATGGCTTTTTCATTAACGGATTGAA
GTTGCGAGCTCAGCTGTATGAGGAGCTGGGGGCTGTCGAGGACGCCGAGAAGGACTACTCGTCTATTATTCACGCGCACTTCGATAAGCCTGGGATCGAA
GATGCTGCCTCTTCCGGTAAGGTTACTATGGAGCTTGCGTCTGGTGGGACGTTAAACATCGGTGGCCAGGGAAACAAAGACTCTAACATGTCTGGAAAGA
ATGGGAAAGGTGGAGGAGGTGGTAAAATTACGAGCGAAGTGGCGGCGCAAGCTCTACTGTGTCGTGCGCGGTTACGGCTCGCTAGTGAGCAGTTCGATGC
AGCGGAAGAGGATTACTTGGCGATCTTGAAATCCTTCGCCAACAACATGGAAGCGCAGCTGGAGTTGCAGGAGACCTGTGAGCGCAAGGCTGCGTTCGAA
GAGCGGAAGCAGCGCGAGGCCCTGGCCTGGCTGGAACAGAACGCCGACGATAATGATGGAGCTGGAGTTCTAAACGCTAACGTGACATCCGGTAAGAACA
AGAGGAAGAAAAAGAAGAAAAAGAAAAAAGCTAGCAGTGGCAGTACTGCTGCTAATGCCGGTTCTAATGGCAAGGCCCCGACAGGGTACATGTTGCTTGA
GGATGAAGAGGAGTTGCTTCAACTGCAGGAAGAGCAGCAGCGGATACAACAGCAGCAGGAGCAGGTGCAGAAGCAAATACAAAAGCCGTCGTCGCCCCAA
AATGCACGAGATACCAACAGGGAACCTCAGGATGTGAGGAAAGAGATGCCTTCTTCACCTACGATTACTGGAGAAGCCCCGGAACATAAGCAGCAGAGCT
CAAGCATTGAGGCTCGGAAACCTGTGGACAGTGAGTCGATTGAGCAACAGGATGCAGAAGTAGTGGCAGCAAAGCTACCGGGAGATAGTGCTTTACTGGA
TACAACCGACAGCGATCATGAAGCGCCTTCGATTGAAACCGAGGTTACAGGTGAA