Description :
From Genome Similarity Track
Location :
scaffold_3:1530034- 1531048
Sequence
1014 bases(100 bases per row)
AACCTACagcatttgcagcggggctatcgtagctttttgctcagaggaagcttactaaggtcaccgaccttacgtgcTATACTATAACGAGTACgattgt
agcggatcgctatCCGCatcctccaagagtacccaaaaccttaacccaaagcAAATACACCCTTCCATTCCAAATTGAAACTTTATTTATCTGttatatt
tgcggcaaagacgCCTATATGTAAGTCTCTAGGGTTTCCTAATTGAATAGTAAACCCTAATCAATGGACATAACTATTGGTagaagtggcttcttgttac
agtgtagccacaccattgtgtgattataccAACATTTATAATCCACACcgttacaccatcttgtgtgactcaccctttcataccagatTACatttaaccc
cgttacagcattCGTCTGTCGAGTTGTGGACTGTTCAGTACATAGCATCTTGATGCGCTTGCCATAAACCCCAGTCAGCTTAACCGTTCTCTACCAGAGA
CTCGCAATTCCTTCCTCGAGAAAACATCTGTTGATATTAGGATAGCTTGAATTCCTTTGTAGCGATGATGGTAGTCGACCATCCTCAACCAAGTTAAACA
GCAATATTACACAGCCTTTGACCCTGCACAACTCAGCTAAGCAAAATACAAAGCCCTCAATACCATGTCTTGGCTCGGAAACACATTCAAACTTCGCTTA
TTGCCTTCTTGGGGTGCACGGGAACATTTTTAGGTTTCTTTTCGAAAACCTGTGTTTTTAAGATCAATATTCAGCGATGAGCCCCAACTTTTGACCAAAG
CCCGCAATTTGGTCATTGCCACTTAGGGTATATGATGCGTACATTTTTGAAGCTCCACCGATTAATCGcgtcaaaagcttttctCATGATTTGAGCAAGC
TAAGCTTTAGTGCACTATAGTTATTGAGTACTTCATCACCCTTTAGCTCAGGTATAGCACGACAAAATATTGCATTCTTGCGGTCAATTCGCTAAGGACT
ACAATGTAATCAAC