Description :
From Genome Similarity Track
Location :
Scaffold_1421:1530- 5934
Transcript NameFunction/comments
Phypl_g13365hypothetical protein

Sequence
4404 bases(100 bases per row)
CGGTAGCTTTGCCTGAAAATCTGCATCGCTCAAGCGCTGGTTGATCGGCGTCACGAACTCGTAGCTGCTGAACAATGGGCCAGCGTACATGACGTCGTTG
ATGACAAAGAAACCCACGACAGGGTCACCCACGCCCAGATTCAAGATGCTCCCTGGATCGCCGTGCTCCACTGACGGAATATCCGTGTGAACGTCCACGA
CCAATACATCGCGTTTGCCGGAGTCCTGGGGAGAATCGTAAAATAGTCGGGGGTACCAACCGTTGTATTTGGTCGCTCCGCTTCCACGCGTTTGTTCCAT
CACCGACTTCACGAATCTCACTTGCTCCGCGTCCAAATCCTCGCCTTTCACTTGGATGCGCGAGATTTCTTCTagcgtcttcatcgttgAGGCGAATGTC
TCGAAGACTCGACACCCTTTTTCGATCTCGTATCGATTGCACGACGTACCTGCAAATGTGTCTCGCACTTGACCAGCGATGTCCTTCATGCGCTGCGCCA
ATTCTCCCATTCGTTGCCAAAACACCGGGTACGGATCCACCACTCCGTCTGGATATTCACAACGTGTTCCGCACGTATAGCTTTGCTTCGCGTAAAGCAC
TGTGtcgtggcggagctgcgtgAATGAGGCAAGCTGCGTGTTCACCTGACGGCGCTGCCACGTTTTCGAGTGAAACACTCGCGCTGCATTGGGTGACGGT
CTTGAGAGCGCTCGAAGTGCTTGAAGCCACAGCGTACAGATACTTGCGTTTTCAGAGGCTGTACCGCTTGGCTTGTTgacgtcgccatcgtcgaactcct
cgtcgatAACTTGGCGCAGCGCTATCAGGTTTGACGCAAATGGGATCCCGTCACGGTGTGGCACAAATTCCATGTCATCACCACTCGCATCATCCGCTGC
AGGTGCATGTGCCTCCATTCGACGAGCGATCTCCGTGGCTACTTCGTTGATACCAAACAGCGTGAAAGCAACGTCGAGAGCGCTTGGTAGACGGCGAACC
TGCTTTGTTCCGTCTTGCACCACTTGAGTCGTGTGAAGATGAACGCGCTCCACACTAAGCGCTGACCAAGTAGAGCGAATGAAGTTGGTCGAGCAGTGgg
agttgctgctcctgcgaCGAGGTCCTCCACTAGAGGATGAGCTGCTTTCCTATTCCTTTCTCTACAATCTGCGCTTGCAGACTAAGTAGAAGTTTCTCCC
TCTCCAGCTCAGAAATGCCGGTCTTACCCAAGGTCGAGGCCGCCATGTCCGTTGGAATCACAAGCTTGGCCAGTTTGTTCGCTGAAAGCGAGTCAGCTCC
GATATCGCTGTCCGCAACGAGACACGAGATGAGTGAATCGGCTCTTTCGACATCACCTAACCTGTCCGAGGCATGAAGACACTGCACTAACACGACTGCA
CACAACAACTGGTGCAGATCCTCATGTTGATGGTCTCCACCAGCGATGCGAAAGTCGGTCGTCCCGAGCCACACCATCGTTCGGAAGTATCGCTTCAGTT
CTTCCGACTTGGTATAGTGTCCACGAGGCTTCAAGAGCGAGAAATCAACCGCACGTTGAGCCGAAAACACTACAAGATCGGTGGTTTGCTCTGCTCTAAT
TGCAGCCCACAGAGCGTTGAGTGTGGAGGatttctgctgcagctcacctTGCAACAAGCTCAATCCAATCGTCAAGTAATCGTTCACATCCTTCAGAGCT
TTAGAGACCGACGATTCCGCTCCCGATGTGGCTGACAACATTTCCTGGCACTGAACAAGCGATGAACTCAGCACTTTATCCAGCATCGGAGcgagctgcg
tcgtctccaaCTCAACCAGGAACGCGTCGAAGCTACGGTGCCATGCATGCAAAATCGAGTCCGTCGTCACGTACACGGGCAAGTCGTCCGTGTACAGTCG
GTAGTAGACTTCAGCAAAGCTCAGAGCTTGCATCCGTTGTACTGCCACGACCCCATTGGCTTCCAGCTTGGTCTTGTCCTCCGGCGTCAAGCGGAAGTCA
AACTGTCGGTTCTTCTTGAGtgggtggtggtgcttggacgtttgcagttgctgcatgAACTTGACTCCATGGAGTTTctgagcttcttgacgttCCGTTT
CCATCTCTTCCCGAGCTTTGGCTGGATCAGCATTGAACAAGTCGAAAAACTGgcacttctccagctcaaTAGGTGCGTTGTCTGGCAAAGACGGAGGATA
CCTGTCCACCAGGTCCTTCGACGTCAAGCATGTTCCCGTTCGTGCCAAGACAGCATCGAATGTAGCTCCGATATCGCCTCCACCCAAGTCTCCCAATCTT
GGCGTCTGGAGTCCCAATATACAACGCGAAATTGCCACCACGAAAGATTGACAACGGTGGCCTAGAGGTCGCGAACGACACACGTCACAATTTTTTTTTG
CGTCCATTTGGTGTGAGGACAGAAAGCTCTGGTGTTTTCCAATGACGCCGAGAAAGCTCAATGGGCTCTGCGCATGCCCAaaatcccccccccctgtTTG
CGTACCTGTGTGTACAAGGCCCAGGGGTGGTCGTTGCTCTTACTGCCGTCCTCCCTCCAGGGAGACTCTCACTAACAGCAAGGATATCGTGGCCTTTTGT
GCTGAGGAGTACCCAGAAGTTCGGCGTCACGAACGCCAAGACCAAGGTGCACCAAACGAGAAGGCGAAAGATCAGGAGAAATCCTTAGACGCTAAGCTAG
CGCAGCGTCAATGGTACCAGTGCTCTTTCCTGCGCTGAGACTTCTCATGGTGCGTGGCATGAGCCTCAACGAGAAGTCCGCGGACTCAAAAATGAAGGCG
TATTGAAGGAGGCTGAAAAGGACCTCGGCGACGGGCCCATCGGCTCTCGATTCCTCGTTGGCGACGCTTTCTCGGCCGCCGACATCATGTTCTGCTCCCA
TGTTGCGCCCCTCGTCCTGCCTCCAGCGCACGAATATCTCGCCCCGTACGTGGCGATTCAAGATACACTCTTGCGCGGACGATTCGAGGCGCCCTGGTGC
TACAGGAACAAGTCCAATGCCggcatgtagccattttcGTTGTTGAAGTGCCTGGGCGTTTTTGTATGGAGCGGCCTGCCAATCCCTTGTgacttggtgt
ttgtatgCTCCAGAAGTGAATGGAGGAGAGGAGCTGGTTCtcgctggacaagtacgtggCGTCCTCACTCTGCAATTTGACCCGTGGTGAGAACTTGCGG
TGTACGGTAGTTATAAGTGTGTATTGTCGCGACAAGTCGATGCTGCGCTGTGGGACTTTATGAGGGCACGCGTGCAAGGGCCTTCAATGCTTGGGGGGCG
CTGAAAAGTGCTTCTCTGCATTGGAGGGCCGAGGCATGTCGTGTCACCCCCACGGGCGCTAGAGAGAACCCCCAATGACCCTATGTGTgtagaggacgac
gacttgccCGTTCGTCAAACTCCTCAAGAACTGGGTCGTACATACCAAAAACAATCAGTGTAGTTGATAGCTTCTAGGTGGATTTATAAGCCTCGCGTCG
TGCGGTTATCCGAGCTGTGCTGTCCTTCAGCGTTCTGCGTgtcttggcctcctcgtcgctaGAGTGAATGCGTCTGAGTGACGGGGCCGCATGCAACCTG
GCCTTCCGGGTCCTTGaactgccgcagcagcttggtaTTGTACGACATGCAGTCGTCGTATTGACACTGCACACAAAACAAGGAAATACACGTGAGTGTA
CGTCGCTAGGACGCCGGGGAGACGGTAACATGAACGCACCTTGTGATAAACGAAGTGGAACTTGGTCGTGGACTTGCgctcgcagtcgctgcagtaGATC
AGCGACTTGTAGTCCTCGTACTCGGTGGGCATACGCTctcgctcaagcagctcgtcgatgctGGCGAAGTACAGCTCCATGTCGCCCAGAGATTTGGAGC
ACAGCGGGCAGATGTAGTTTgtctgcagcgtcaagaGGAGCAAGAGCTTAGCAGGCTGGTACTAAGTCGTCAACAAACACAAGCAATCGCGCTCACGTAC
CAGCGTGTACTCTTCGTAGCAGGACACGTGCATACAGTGTCCACACGGAAGGAACATGactggcgtcgtcgacgtgaACATGTACGCATGGCAGATTGGG
CAGTCCGACTCGAGCGACCGCTCCACGCActtgtgcttcttcaaaCTGATGCTCATGCAGGCATTGCACCGATCGCAGTGGAAGTAGTCGATGTCCAGGC
CCTTGCCAATGCGGCAGATCTTGCACTTGTCGCAATGATAGATGTCCttgctgttgtcgtcgtcgatgaatTTGCACACCTCGCAGTAATAGCGACCGAA
TTCACTTTTGCAGTCCTCGTTCACACAAGTTTGTCCGATCGGCTGGACTGTATCACATTTCATGCACGATACTGACTCGGTAGCGTAGCGATCGAACGCG
TGAT