Description :
From Genome Similarity Track
Location :
Scaffold_888:153- 7910
Transcript NameFunction/comments
Phyag_g8557hypothetical protein PHYSODRAFT_354319
Phyag_g8558conserved hypothetical protein
Phyag_g8559putative malonyl-CoA decarboxylase
Phyag_g8560hypothetical protein PHYSODRAFT_313210
Phyag_g8561hypothetical protein PHYSODRAFT_558953

Sequence
7757 bases(100 bases per row)
agctcgcgccatgaagaagaaggtgagTGTCTCTCCCGTGCGAGTGTCTGTTGTGGGGGCTCCCCTACTGACAACACAAGCGTCTGCCGCctgtgcgtgc
tgctgcaggttctgTTAATGGGCAAGTCCGGCTCGGGCAAGACGTCCATgcgctccatcatcttcgccaactACCTGGGTACAAAGAAGTATGTTGCCTG
TGTGATTCGAACCGCCCTCTCACTCCATCCCATGTACTATTACACCGATTAATCAGCTCGTGATACGATGCGTCTGGGACCCACGTGTACGTGATTGAAG
CGCAGAATTGACTGAGGATTTTAAACCCCAGGAGAATGACGGGGTCTTTGGctatttgctgctgttttgtAGTGGACGTAGAGCATTCGCACGTGCGTTT
CCTGGGCAACTTGGTTCTGAATCTGTGGGATTGCGGCGGGTAAGGCGACAGCAGAGGAGTTGCTAGACTTGGAACCGGAGCTGATTTCATTGCTTGTGAT
TTTCGTAATAGTCAGGACGCCTTCTACGAGAACTACTTCGAGAGCCAACGCGATCACATTTTCCGCAGTGTGGAGCTACTGATCTATGTGTTCGACATTG
AGAGTCGCGAGATTGACGTACGAAGTGGATTTGGCTCagtgggggggggggggggggggggggttaGTTGCGCTGTTGGGTGATGTTGATTTGTGTTGTT
GGGATTGTTGTTAACGCGTTACAGAAAGACATGGCCCACTTTGACGGCTGTTTGGAGGCTATCGACCAGAACTCGAGCAACGCGAAGGTGTTCGTGCTGA
TCCACAAGATGGATCTTGTGCCCGAGGATCAACGCGAGCGCGTACGTGGCCTCGCTTGCTTTTGGCGATTTATCTGATGGAACATGGAACTTAGCGTTGA
TGTTTGTTGGTGTGCAGGTGTTCAATCAAAAAAAGGAGATGATATTGGAGCGCACGGGTCAGCTCCCGACGGTGTGCTTTGGCACGTCTATCTGGGATGA
AACTCTGTACCGCGCGTGGTCGTCGATCGTGTACTCGCTGATCCCAAACATGCAGGATCTGGAGAAGCACCTGAACAGCTTCTGTTCCATTTGCAGtgcg
gacgaggtggtgTTGTTTGAGCGGGCGACTTTCCTTGTGATCTCACACGCCACGCACACGAACCACCGTGACATTCATCGTTTCGAGAAAATCAGCAATA
TCATCAAGCAGTTTAagctcagctgcagcaagaccCAGGCGCAGTTTCAGGGCATGGAGGTGCGCAACTCGAACTTTACGGCATTCATCGATTTCTTCAC
TGCCAACACGTACATCATGATCATCATGTCCGACGATTCGATCCGTACGTAGCTACTATGTTTGGAAATTGCGTTGTATTTGACAATTGATTTTGTGGTT
TTTGCTGGAGTAGAACCGGCGACGATCCAACTGAACATCAAGGCAGCCCGCCCCGTGTTCGAGGAGCACGTGCAGCAGACGAGTTAACTGTTTTTGTTGG
CAATCTGCATTGTTACCGGTATCGTCAAATGCCCAGGTTGCCATAGGGAGAGAGGAACCCTTCATTCATGGATAAGAGCCTAGTGAACGAGCAGTTTCTA
TCGTGAAGTCAGGATTCTTTATGAAGTTTCATATTCGCGCCGGAAGAGTGCTAGGGCCTCTGCAGCGTTCATTGACGAAATACATATAAATGAAGTTACT
GCGGTGGGGGCGACGGCGAATTGGTGGGAGCCAGCATGTATCCTCTGCGCCTCAGCGCACGTAGAACCACTGGTGTGACAGCAAACGTAAGTGGCCACCG
GACGGGGGCCAGCACTTTGTAGATCGTGTAGGCGATGATGAAAGACCCAGCCGAGTTGGTCGTAGAGTCACTCACGGATGTGGACAAGCCCACCGAGTCC
AGAATAGACGTCACGTCCACACCACTAGAGACGCCCACGTAGATGACGgagaacgacagcagcgacagcacaATGTGCGTGCAAATGCCCACGCGTCCGT
ACTCGATGGCGAACGTCTTGGCTCGTTGACGCCACGACTGCTGGGGAGGGGGAAGTTGCTCCATCGGCCGCCCTAGCTCCTTGTCCACGTCATCACCCTC
AGTCtatagcagcagcagcagcagcagaaacaacAAACAATGAGCCAACCAACCACAGTGTCAAACTCTTCCAACTCCCAGGTACGAGGTGAATTCGTAC
GTTGGCTGAAGACGTCGGGTCTCCTCCCGTCAGTGGCGCCGTCTCTTTGGAGTCCTTGGACGCCCTGCCACTGGACCAGAGGCGGCAGTTAGCGCTGCTG
TAACTCACAGCAAATGGCGACGGGAAGCCAAACAAACggcgcgacgcagcagcagcagcaccagccccAGCAGGCAACGGAACTTGGGACCAGCAGGAAG
AGGGAGGCGGTGAAGACATTCGACTGATGCGACTGCTATTTGGGGCCATAGACGACAGAGATCGAGCCGCGAGGAAGCGcacgctgcgctgcgtcaCGCC
TTGGTACACGCACCTCATTCCGCTGCGTAGCATCATCGAATGtcaagagaagaagaagaagaagaagaaggagctctGCACCAACGGGGAGTGTTAAGCG
GTCTTCTATTGCATCATCGAATGTCAACAGTGTCGGTCGCCCACTACGTGCCACACATCAAATACGACAAGTTAAGCTGGACACAGACCAAATAACTTGC
CCCACTTTGAAGATTAGGTGATCGATCAGCCATGCTCTCGGCTTCGTTGCGCGGCCTCTGGGCGACACGAGGCGCGATCCACCGTAATGTACGCAGCGCG
TTAGCTGGTGACGCAGCCTCCCGATTGGCTTTAAGGTCGATGGGTGTCGCTCAGCACGCGCTTTTCGCCACTACCAGCGAGAACGGAGGAAATCAACGCC
AGCAGTCCTCGTTCCTGCGCAGTGTCGACCTCAGCGACCCGGCGGCGCAGCGGAAACTGTCCAAACTGATCCAGGAGGTGGTCAAGACGAAGGCCAATAC
TGGAGGTGCGAACTGTAGCAGAGAAGAAGGGAGACAGGACAAGACTCTGACACTTGGCGACTAGATTTCGTGCCGCAGGTGGTGATCCAGAGTCTGTGTA
GCACGTACCGAGGCATGAacatcgacgagaagaagcaattTCTACTCATTTTGGCGCAAGATCTGCATATTGACACGAATTTGGTGGGGATTGAGACGGA
GGGAGCTTGTGGCATTGACTGCTGCGGACTGACTGGTGTTTTTGGCTGCTTGCTCCTGACGATGAGTAGGCTCTGCAGAGTGCTGTCCAGTTTGAACAAA
ATGTAGCTAATGTGAAGGGTTCTCGCACTGGGTTAATTGAATGGGAGCGCGAGAACGTGGAGAGGTACTTGCGCACATTCCGAAATCTTCGCAACGCGTT
GTCACCACTTTATGAGGTAATGAACATCAATCATTGATTGGAAAGTATCGAGGAGCTGACACTGATGGTATTTGTTGCATAATGAGGCAGACCTTCTTCC
AGCAAATCTTGTCGCAGCGCGAAAACGGCATGTTGTTCTTGGTGCACATGCGAGCGGATCTACTGCAAGTTTTGCGCAAAAGAGCGATCCATGCCGAAAT
CCCTGCTCTTCGCTCCCTTGACGGAAGCTTAAAGGTGCGCTTCAGGCTTGCGTCCATTCCTCACCCGAGACTAATGCTGTGCTCGTTGTATGCACTTGGT
ATCTTACGTTGCTGCATAGCAATTTCTGGCGTCATGGTTTAGTGTTGGCTTCCTGAAGCTAGAGCGTGTGACCTACGAACACTCTCCTGGCCAACTTTTG
GAGAAAATCATTCGCTACGAGGCGGTGCACCCAGTGGGGACGATCGCCGAGCTAAAGAGACGACTTGGTATGTTTGGAGTAAGTTTGCTTTGGTGCTATT
GTAACAGACTGACTGATGGATGCATTATGTTGCTATTGTTTTCAGGCAACGGACGTCGTTGCTTTGCGTTTTTTCATCCGAGGTAAGACATTCATCTCCA
AAGCTATTGAAAGCCAAGCCTGATACCATGACTTCTCTTTGGTGTAGTATTCCGGACGAACCCTTAGTATTTGTGCATGTAGCACTGATGCAAGATATCG
CCTCCAGCATGCAGTCCATTCGTGACGAAACGGAGCAATTGACAGAAGCCTCTCAAGCGAAAGCTGCAATTTTCTATTCCATCTCTTCAACGCAAAAAGG
ACTTTCGGTAATTATAAGCCTTGCATGTACACTGGACATCGTCGAGCTAATTAACCGCATCTGTTGTTGGTTGCAGGGTGTGGACTTGGGCAACTTTCTC
ATTAAAGAAGTCGCCAAATCTCTCAAGACAGAGTACCCGCATTTGAAAACATTTGCGACTCTGAGCCCTTTACCACAATTTCTGCCATGGCTCGAAACGC
AGCGGTGCAAGACTGATGAGTCATTAGTATCCCCGCTTGAGCTGGACGTCCTGATCGATGTACTGGGCGAACGCGGGGCCCCCATTCAATTGGACGCAAC
TCCAGTCGCCATTGTTTTAGATGCGCTAGAAATCGACGATTGGAACGAGGATTCGGATCTGGTCGCAGCACTAAAGCCTATCATGCTGAAGCTCGGCGCA
CGCTACATCTACCACGAAAAGAAGCGTGGAAAGGCTTTAGACCCTGTAGCCAACTTCCACGTCCGAAATGGCGCAATTTTCGAGAGAATCAACTGGATGG
CGGACCTATCTAAGAAGGTGCGTACCTGTGAACGCACTGTGTATAACGCCTTATCATTGAATTTGTTGGCTATCGTTGTGTTTTAGGGTCTTGCGCAAAG
TGCTGGGATGATGATCAACTACAAGTATGATTTGGCGCATGTGGAAGCAAACAACGAGAACTACTTGTTGCACAACATTATCCCCATCGGACTTCAGCCG
CAGCAAGTCCTTTAGCTGCGCGCGTTTGCACGTATTTTTCAATTTGTCGACGACCGAGCTGAAGAAATGAATTCAGGTTTTGCTCGACCACAGTTATCAT
TGAGCCGAGTCAATTTTGGTGCTTGCGTGAAGGGTCGGACAGCCAAGAAAGCTTGATCGAGTCGCGATGGTGCTGGCACAGGACGAGATCGATGCTTGTC
GAGAAGCGTTCCTGGCCTTCGACAAGGATCGGTAAGTGCCTGCCAAACCAATGCGTTTGCGGAGATTCCTGAGCTGACATGCTGTGGGGAATTATAGGAG
CGGTACAATCGATGTCTGGGAGCTACGacaagtgctggaaggtCGAGAACCATGAGTCCTTCTGTGGAGGCTGAAGACCAGTTATTCCTAATACTCTCCT
ATGAACTAGCAATGGGACAGCAGCCAACCGAAGAAGAATTGTTTCAAATGATCAGCGAGGTTGACGAGGATATGAGCGGCGCTATAGGTGGCCAATTGCA
TTACATCAAGATATTCACTCCTCGAGGCTCACAATGCCCGTGCTAGACTTTGCTGAGTTCCTGCAGGTCATTGACAATCAGAAAGATCGAGCCGCTATGT
TCGAAGATGACAGCGACATGAGTAAGCAATTTCATATCCATGCGAATGACAGTCGCAGTCCGTGACCTTGTTCGTCTTTGGCTGGCTCGCAGTTGATGCA
TTCGTTGCATGCGGTGGCAAACCAGACAAATCTGGGTTCGTGCGCAAGGAAACACTGGTGAAAATCATCAAGGGCGACTTCGGTCTTACTATCAATATCG
AGGAAATGATCAACAAGCTGGACGTGGATGGGAGCGGAGAGATTGaattcgacgagttcaaAGCTATCTTGACTTGATTCCTGCCTGGTCTGTAAGGAGT
AACTCACAGGAGTTGGTAAACAGAAGGAAAAATATGTCGAGCGCATTTATGAAAATGCTACATGTAGCGATTTTTTCTTGTCATGGGTCAGTCATATCAC
CGCGAAAGTGTTGGGGCAACCTGCGAGTCAATAAAACGTAGTCTTGTAGTGGGGAACTTGAATAGTGTCCGCGCTTCAGTTGCTTCGTGTTCGTTGCTTA
TGAATccactttttgctgctgtgctctcTTACCAACCGGAGattcgactgctgctgctagttgCCCCATGAGTGACGCATTCAACACTTTCCTCGAGCGT
TTAGGCGGCATATACGAAGAGGCTGTTCCGAATGGATACTGCTACCTCATTCAGTGAAGGGTGCCAGCTAGTCTGCAAGATCTTTTTCGAGAAATCCAGT
GCATCAGGGTCACCTGGAGCAGGAATTGCTGCTATCTGCTGCGCGAGACCTCGCTGTGGCATGGAGTGGCGCCGACTCACTCGCGCAGTACGAGGTGTGA
TGGAAATGTCGGCACGTCCATAGCGGTCATAAATATGGAACTCGCTATTGTACGAGCCCGTGATGAAGTTATTGCCGTCCCCGCTGACCGCGCACTCGAA
TTTGTCGAAAATACAGTCGCTCTCATACAAGTCACCCAGTCGCGGCCGTAGGTGCTCATGAATCTGCTCACCAACAAGTACAACACGAGCCAATTAGCAA
CGAAGGCCATGCAATTATTTTGACAACGCCTTACATTGATCGTTTGAACTGGCCGCGAGTTCATGTTGATGTCCCAGACTTTCAGTGTGAGGAAATCGCG
CGCGATAATGTATCGACCGTCCGGAGAAAATTTGATATCCGAGATAGACGCGATGATCTCGGAGAAGAAACTCCGTGACTCAGGGTCTTCCTGTTCTTCA
AAAACTATATTCCCGCCCAGTTAGCaccgcaacaacaacagtgTGTGCAATATAGTCAGCTTCTCGGTGGTATGGCCAACGAGCGATCCGCACCTTGAGA
GTAGGAATCGCACAACGCTGCCTGGCGCATGTCGCCGAGCTTAATGGCGCCGCGACTCGTGCTGTACATCATCGTGCTGCAGTGCGTTGGGTGGAAATCT
GCGGCTGTGATGACCTCAgtgagctcctccatgttAGCTGGCTTGATGTCCACAATATCTACATAACCACAGTCCGTCATTAGCGTAACATCCAGGGCCC
AACTGGCATATTACTTACTGAAGCTTTGGTTGGATATGCCGAGGCTCCACAAGTTCACGCGAAGGTCGTCTGCCGACATGAAGGTCTCTCCGTCGCTGTT
GATCGCAATCGAATTGATGTGGTACGTGTGCGCGTTTGCGTACACCCTTTTAGCTGTAGACGTCGTCACTTGTCCACGAACGTGCGTGTGAGGCAGTCGG
ATGAGCTCTGGTGTAATTTGCGTCCGCGGCACGTGGGCGAGTCCCTGTTCATTGTACGTCGTGACCTCTCGGACGCTACGTTCGTGCACCTTCCAGAGTT
TGATGGTTTTGTCGTTTGTGGACAGCAGACAGTGGGAGCCATTGGAAGGTCTGCACCATTTGATTTggttgatcttctcctcgattTCGAGACTCTTGAG
GTAGTCAAACTCGGCGTTGTGGCTCTGGTACTCGGTGTACAATTGGTATCGCGGGTCGCTCGTGCCGCTGTAGATATTTTGATTCTGCATTAGACGGCCA
CCATTAGCAAAATATCGCACTAAAATAAGCTAGCACGACTACCTACGGACCGATGCAGGGTTCCCGTGGCGATAGTAGATGGAGACTCGTCCGCCTTTGT
TGCCTGTGGCTAGAAAGTCTCCCGACCGGTCGTATTCAATTGCTGAGATCACCTCGGCTGCACGTCAACAGATATGAACGTTAGCACTTCACATCAGGCT
AAATAGAAGACGTACGTACCTTCGACAAAGCTTCGCGTGCTTTCCCCGGCTGAGAAG