Description :
From Genome Similarity Track
Location :
Scaffold_1152:153- 1810
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_1152-fgenesh-gene-0.1Formate-tetrahydrofolate ligase

Sequence
1657 bases(100 bases per row)
AAGCCGGCCTCCGTGACCACGTAGCCGTCCTCGCCTGCGAGCTTGAGCGCGATCTCGTCCGCGATGATCGACGAGTTGCCGTGCGCAATGTTGGCGAATG
GCCCCGCGTGCACAAACACAGGCGTGCCCTCCACGGTCTGCATGAGCGTCGGTTGGATCGCGTCCTTCATGAGCACGGCGAGCGCACCGCCAACGCCGAG
GTCGTCCGCGGTCACGGGCTCGCCCTTGCGATCGAGGCCGATAACAATGCGCCCCAGGCGGGCGCGCATGTCCTTGAGGCTCGTGGTCAGCGCCAGGATA
GCCATGATCTCGCTGGCCACGGAGATATCGAAGCCCGTGGTGCGTGTCTTGCCCTTCTCCGTGGGGGCCACGCCCACGACGATCTGGCGCAGGAAGCGGT
CGCACACGTCGAGTACACGCTGCCACGTGATCGTATCGGGGTCGATGTCGAGCCGCGCGAACCGCGAGATCTCGTCGTCCGTGAGGTCGTCAGGCGAGAG
CTTGGTGATGCCGAGCTTCTCCAGCCGTGTGAACATCACGGGCGCGAACTTGCGCGCGCCGTCCTTCCCACGAGGGCACAGGCGGTTGAAGAGCGCCTTG
TCCTTCTGGGACGACTCGTGGAACATGCGCGTGTCGATCGCAGCAGCCAGCAGGTTGTTCGCGGCCGTGATCGCGTGGATGTCGCCCGTCAAGTGCCTAT
TGCAAGCACGAGAAGTTCCGTTAGAGCAACATTATCTCATAAAGGACGGTAGAAGAGAATGGCTCGTACAGGTTGAACTCGTCCATGGGGACGACCTGGG
CGTAGCCGCCGCCGGCCGCGCCACCCTTGACGCCGAACGTCGGGCCTTGCGATGGCTGATCATACACATACTCAGTATCAATGGACCCACAGCCACAGTA
CAGTATTGCACAGTCGTACCTGGCGAATACAGGCGAACGCCTTCTTGTTCAAGTGAGCGCCGAGTGCCTGCACAATGCTATAGGCATCCAAATACCACAG
CAAAGAGCACACAGCCGTTAGTCCATTACTGAGAGTGATACAAGTCCATATGGAGTTATCCATACCCGATCGTGGTCGTGCTCTTGCCTTCGCCCAGCGG
CGTGGGCGTGATGCCGGTCACGACGACGTAGTTACCGTTGGTCGCGCCACTGAGGCGGTCGCGCACTGCGAGCGAGATCTTGGCCTTGGTCACGCCGTAC
GGGATCACCTCGGACGGGAGCTACACACACACAACAACACATCAACACACGGTCAACTATCAGTCCACCCCACTGAACGAATCAATATGACGTACGATGC
CGGCGGCGGCGGCGATGTCGCTGATGGGCAGCGGCGCGATCGCATCGCTGATCGCGATGTCCGACGGCACGGGGGAGAGCAGTTGCTCGGGCGTGAGCGG
GCGCGCGGACATGGCGGAGCGAAGCGGACGGAGGTGACTTGAGCTGCTGGCTCTGTGGACGGAGCTGCTGGAGGAATTGTGGGGTGGTCAAATGGCGTTC
GTCCGCATTCTTGTGTGTGGTGACTTCCAAGTTGAAAATGCTTTTCAGCCAATGAGAATGCACAAAGGATGTTTCCAGCCAATCACGAGACGAATAGGAA
CGATTTTGTTTTAATAGGTACACTCGGTTAAGTACACTTGAAGTTCGCGAACACTTT